Incidental Mutation 'R9712:Zfp28'
ID 730253
Institutional Source Beutler Lab
Gene Symbol Zfp28
Ensembl Gene ENSMUSG00000062861
Gene Name zinc finger protein 28
Synonyms mkr-5, 2810438M17Rik, Zfp-28
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.140) question?
Stock # R9712 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 6383295-6396915 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6393879 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 438 (C438R)
Ref Sequence ENSEMBL: ENSMUSP00000079812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081022] [ENSMUST00000161855]
AlphaFold P10078
Predicted Effect probably damaging
Transcript: ENSMUST00000081022
AA Change: C438R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079812
Gene: ENSMUSG00000062861
AA Change: C438R

DomainStartEndE-ValueType
low complexity region 27 50 N/A INTRINSIC
KRAB 103 163 3.53e-33 SMART
ZnF_C2H2 377 399 3.95e-4 SMART
ZnF_C2H2 405 427 6.88e-4 SMART
ZnF_C2H2 433 456 1.2e-3 SMART
ZnF_C2H2 462 484 9.58e-3 SMART
ZnF_C2H2 490 512 2.57e-3 SMART
ZnF_C2H2 518 540 1.82e-3 SMART
ZnF_C2H2 546 568 2.4e-3 SMART
ZnF_C2H2 574 596 6.32e-3 SMART
ZnF_C2H2 602 624 1.38e-3 SMART
ZnF_C2H2 630 652 4.87e-4 SMART
ZnF_C2H2 658 680 2.91e-2 SMART
ZnF_C2H2 686 708 2.36e-2 SMART
ZnF_C2H2 714 736 6.42e-4 SMART
ZnF_C2H2 742 764 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161855
SMART Domains Protein: ENSMUSP00000130202
Gene: ENSMUSG00000093536

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
transmembrane domain 85 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207086
Predicted Effect probably benign
Transcript: ENSMUST00000207465
Predicted Effect probably benign
Transcript: ENSMUST00000207809
Predicted Effect probably benign
Transcript: ENSMUST00000208338
Predicted Effect probably benign
Transcript: ENSMUST00000208949
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A T 19: 3,715,784 M20L probably benign Het
9430007A20Rik C T 4: 144,528,784 A258V probably benign Het
Abca8b T A 11: 109,942,337 D1241V probably benign Het
Adam20 G A 8: 40,795,453 R200H probably benign Het
Adcy10 T C 1: 165,513,112 F229L probably damaging Het
Adsl A T 15: 80,955,639 N126I probably benign Het
Ahnak AGATCTC A 19: 9,007,028 probably benign Het
Ahnak GATCTCTAT GAT 19: 9,007,029 probably benign Het
Aktip G A 8: 91,129,727 P41S probably damaging Het
Alkbh3 C A 2: 93,980,973 R258L probably damaging Het
Arfgap3 A G 15: 83,313,533 Y341H probably benign Het
Arhgef26 C T 3: 62,423,613 L583F probably damaging Het
Arhgef40 T C 14: 51,988,958 I153T probably damaging Het
Atp1a1 T C 3: 101,591,441 S179G probably benign Het
Bok T C 1: 93,686,507 S21P probably damaging Het
C130060K24Rik A G 6: 65,456,140 I315V probably benign Het
Ccdc136 A G 6: 29,417,442 E754G probably benign Het
Cers3 A G 7: 66,773,630 K108E probably benign Het
Cmya5 T C 13: 93,065,373 probably null Het
Col19a1 T C 1: 24,328,067 E478G possibly damaging Het
Colec10 T A 15: 54,459,784 S134R possibly damaging Het
Ctnnb1 A T 9: 120,955,829 I514F probably damaging Het
Cux1 C T 5: 136,309,819 E664K probably benign Het
Dars T C 1: 128,405,462 Q75R probably benign Het
Disp1 T A 1: 183,135,815 S16C probably damaging Het
Dnah7a A T 1: 53,559,140 V1412E probably benign Het
Ect2l C T 10: 18,168,434 V226I probably benign Het
Ep400 T A 5: 110,756,643 H30L unknown Het
Ephx4 A G 5: 107,419,781 I202V probably benign Het
Exoc3 A T 13: 74,192,908 F259Y probably damaging Het
Ezr T C 17: 6,752,995 E229G probably damaging Het
Fat1 A T 8: 45,017,380 I1472L probably benign Het
Fsd1l T G 4: 53,679,972 D223E probably benign Het
Gata6 A T 18: 11,059,064 D377V possibly damaging Het
Gm12185 A T 11: 48,907,389 M759K probably benign Het
Gm21994 C T 2: 150,254,576 R311Q probably benign Het
Gm9922 C T 14: 101,729,457 A120T unknown Het
Hectd4 A T 5: 121,310,681 Y364F probably benign Het
Hnrnph1 A G 11: 50,385,869 S465G unknown Het
Ifi204 T C 1: 173,749,358 Y559C probably damaging Het
Ift88 T C 14: 57,481,396 S613P probably damaging Het
Kif21a G C 15: 90,985,325 A441G probably damaging Het
Kif21a G T 15: 90,995,512 T191K probably benign Het
Lrit1 T A 14: 37,060,127 C252* probably null Het
Ncbp1 T A 4: 46,144,837 D29E probably benign Het
Nlrp10 A T 7: 108,925,528 D248E probably damaging Het
Nphp4 T G 4: 152,547,064 V807G probably benign Het
Nsd1 T C 13: 55,246,043 S589P possibly damaging Het
Oas1b T A 5: 120,814,485 N80K probably damaging Het
Olfr1055 G A 2: 86,347,239 H176Y probably benign Het
Olfr1135 A T 2: 87,671,761 I202N probably benign Het
Oprk1 T A 1: 5,598,873 C181S probably damaging Het
Oprl1 T A 2: 181,718,419 N89K probably damaging Het
Pdcd11 A G 19: 47,129,302 K1697E probably damaging Het
Pdp1 G A 4: 11,961,607 H254Y probably benign Het
Pds5b A T 5: 150,805,663 D1419V possibly damaging Het
Per1 G T 11: 69,100,649 G3V probably benign Het
Pex16 C A 2: 92,376,643 N55K probably damaging Het
Phldb2 C A 16: 45,774,977 L862F probably benign Het
Pld5 T A 1: 175,964,006 D478V probably benign Het
Pms2 T C 5: 143,914,796 I177T probably damaging Het
Pou1f1 A T 16: 65,529,872 E119D probably benign Het
Ppp2r1a A C 17: 20,958,796 E295A probably damaging Het
Rad51ap2 A T 12: 11,457,592 N505I possibly damaging Het
Rasal3 A C 17: 32,396,562 V434G probably damaging Het
Rasgrf2 C T 13: 91,987,973 V6M Het
Rwdd1 A T 10: 34,001,156 D197E Het
Scn11a A T 9: 119,790,010 C755* probably null Het
Skil T C 3: 31,116,860 S443P probably benign Het
Slc12a6 T C 2: 112,356,472 C939R probably damaging Het
Slc25a36 A G 9: 97,079,177 S269P probably benign Het
Srrm4 T A 5: 116,482,393 H92L unknown Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,301,649 probably benign Het
Tbc1d4 A T 14: 101,507,410 V260E probably benign Het
Tbc1d8 T C 1: 39,385,232 N593D probably damaging Het
Trex1 C A 9: 109,058,737 R62L probably damaging Het
Trpm3 A T 19: 22,715,352 D269V possibly damaging Het
Trpv4 G T 5: 114,633,150 Y439* probably null Het
Ttn G A 2: 76,734,248 T28515I probably damaging Het
Ucn2 G A 9: 108,986,503 G111D probably damaging Het
Uhrf2 A G 19: 30,056,481 I212V possibly damaging Het
Usp24 T A 4: 106,347,367 M261K probably benign Het
Vmn1r235 A T 17: 21,261,698 D95V probably benign Het
Vwf G A 6: 125,624,573 R826Q Het
Other mutations in Zfp28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Zfp28 APN 7 6393430 makesense probably null
IGL02300:Zfp28 APN 7 6389496 missense probably benign 0.00
IGL02541:Zfp28 APN 7 6393480 nonsense probably null
FR4340:Zfp28 UTSW 7 6394863 missense probably damaging 1.00
FR4342:Zfp28 UTSW 7 6394863 missense probably damaging 1.00
R0442:Zfp28 UTSW 7 6394999 missense probably damaging 1.00
R0462:Zfp28 UTSW 7 6392240 missense possibly damaging 0.71
R0799:Zfp28 UTSW 7 6384183 missense possibly damaging 0.49
R1081:Zfp28 UTSW 7 6389780 missense possibly damaging 0.93
R1674:Zfp28 UTSW 7 6394943 missense possibly damaging 0.90
R1783:Zfp28 UTSW 7 6394792 missense probably damaging 1.00
R2119:Zfp28 UTSW 7 6394876 missense probably benign 0.00
R2186:Zfp28 UTSW 7 6394498 missense probably damaging 1.00
R4280:Zfp28 UTSW 7 6393701 missense probably benign 0.07
R4281:Zfp28 UTSW 7 6393701 missense probably benign 0.07
R4283:Zfp28 UTSW 7 6393701 missense probably benign 0.07
R4331:Zfp28 UTSW 7 6393701 missense probably benign 0.07
R4379:Zfp28 UTSW 7 6393442 missense probably benign 0.11
R4380:Zfp28 UTSW 7 6393442 missense probably benign 0.11
R4505:Zfp28 UTSW 7 6394161 missense probably damaging 1.00
R4659:Zfp28 UTSW 7 6393507 missense probably benign 0.05
R4706:Zfp28 UTSW 7 6389794 missense probably damaging 0.99
R5524:Zfp28 UTSW 7 6394851 splice site probably null
R6269:Zfp28 UTSW 7 6393613 missense probably benign 0.00
R6981:Zfp28 UTSW 7 6394693 missense probably damaging 1.00
R7117:Zfp28 UTSW 7 6394462 missense probably damaging 1.00
R7176:Zfp28 UTSW 7 6383457 missense possibly damaging 0.49
R7312:Zfp28 UTSW 7 6383594 unclassified probably benign
R7422:Zfp28 UTSW 7 6394749 missense probably damaging 1.00
R7423:Zfp28 UTSW 7 6393957 missense probably damaging 1.00
R7937:Zfp28 UTSW 7 6393786 missense probably damaging 1.00
R8110:Zfp28 UTSW 7 6389829 missense probably benign 0.02
R8704:Zfp28 UTSW 7 6394638 missense probably damaging 1.00
R8804:Zfp28 UTSW 7 6390400 missense probably damaging 0.98
R8854:Zfp28 UTSW 7 6394939 missense probably benign 0.01
R9071:Zfp28 UTSW 7 6394545 missense probably damaging 1.00
R9235:Zfp28 UTSW 7 6394606 missense probably damaging 1.00
R9276:Zfp28 UTSW 7 6394441 missense probably damaging 1.00
R9589:Zfp28 UTSW 7 6389817 missense probably benign 0.09
R9600:Zfp28 UTSW 7 6394918 missense probably benign 0.00
R9651:Zfp28 UTSW 7 6392624 missense
R9653:Zfp28 UTSW 7 6392624 missense
Y4340:Zfp28 UTSW 7 6394657 missense probably damaging 1.00
Z1177:Zfp28 UTSW 7 6384187 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ATCCAGTAGTTGTAAAGGAAACCG -3'
(R):5'- TGAAGGCTTTTCTGCAAATCTC -3'

Sequencing Primer
(F):5'- GTTGTAAAGGAAACCGGAATCTGTTC -3'
(R):5'- GCCGTACCTAAAGGATTTGTGACAC -3'
Posted On 2022-10-06