Mutagenetix > Incidental Mutation

Incidental Mutation 'R0783:Eif3b'

76719

Institutional Source

Beutler Lab

Gene Symbol

Eif3b

Ensembl Gene

ENSMUSG00000056076

Gene Name

eukaryotic translation initiation factor 3, subunit B

Synonyms

Eif3s9, EIF3-P116, D5Wsu45e

MMRRC Submission

038963-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0783 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

140419328-140443360 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 140419837 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000098076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100507]

AlphaFold

Q8JZQ9

Predicted Effect

probably benign
Transcript: ENSMUST00000100507

SMART Domains

Protein: ENSMUSP00000098076
Gene: ENSMUSG00000056076

Domain	Start	End	E-Value	Type
low complexity region	4	25	N/A	INTRINSIC
low complexity region	46	59	N/A	INTRINSIC
low complexity region	111	128	N/A	INTRINSIC
RRM	175	253	4.14e-7	SMART
Blast:WD40	317	350	4e-7	BLAST
Blast:WD40	354	397	2e-7	BLAST
Pfam:eIF2A	496	691	1.3e-68	PFAM
low complexity region	700	719	N/A	INTRINSIC
low complexity region	784	797	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.8%
20x: 92.2%

Validation Efficiency

100% (47/47)

MGI Phenotype

PHENOTYPE: Homozygous embryos die prenatally prior to the blastocyst stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	G	A	7: 120,294,157	G1277R	probably damaging	Het
Abi3bp	A	G	16: 56,595,238		probably null	Het
Acsm2	G	A	7: 119,573,117	G61D	probably damaging	Het
Akp3	G	A	1: 87,127,871	G547R	unknown	Het
Bbs9	T	C	9: 22,567,714	L151S	possibly damaging	Het
Camk2g	T	A	14: 20,744,636	T173S	possibly damaging	Het
Eif3i	A	C	4: 129,592,076	F319V	possibly damaging	Het
Eprs	T	C	1: 185,398,458	L672P	probably damaging	Het
Fras1	C	T	5: 96,768,430	A3441V	probably damaging	Het
Gigyf2	T	A	1: 87,407,161	M79K	probably damaging	Het
Grrp1	G	A	4: 134,252,057	R37C	probably damaging	Het
Hdac1	T	C	4: 129,518,109	N331S	probably benign	Het
Hmcn1	C	T	1: 150,650,073	G3300S	probably damaging	Het
Iars2	T	C	1: 185,320,874	E400G	probably damaging	Het
Irx2	T	C	13: 72,632,650		probably null	Het
Itih4	G	A	14: 30,895,423	E567K	possibly damaging	Het
Klhl5	T	A	5: 65,156,253		probably benign	Het
Klk8	G	A	7: 43,802,197	G204E	probably damaging	Het
Loxhd1	T	C	18: 77,429,984	F1843L	possibly damaging	Het
Mllt6	T	C	11: 97,665,745	V87A	probably damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Nhlrc3	A	T	3: 53,462,449	S34T	probably benign	Het
Olfr1099	A	G	2: 86,958,562	C299R	probably benign	Het
Olfr1224-ps1	A	T	2: 89,156,891	C95S	probably benign	Het
Olfr1494	T	C	19: 13,749,676	L190P	probably damaging	Het
Olfr193	A	T	16: 59,110,169	L147*	probably null	Het
Olfr549	A	G	7: 102,554,439	I52V	probably benign	Het
Olfr593	T	C	7: 103,212,670	F259S	probably damaging	Het
Pcnx4	T	C	12: 72,575,478	W1074R	probably damaging	Het
Pcsk9	T	C	4: 106,450,117	T310A	probably benign	Het
Pfas	A	G	11: 69,000,521	L250P	probably damaging	Het
Plk5	T	A	10: 80,361,130	D352E	probably benign	Het
Ryr3	A	G	2: 112,756,327		probably benign	Het
Serinc3	A	G	2: 163,637,003	I68T	possibly damaging	Het
Sez6l2	A	G	7: 126,967,145	T810A	possibly damaging	Het
Tmprss7	G	A	16: 45,667,606	Q487*	probably null	Het
Tnf	A	G	17: 35,201,674	I56T	probably damaging	Het
Ttbk2	A	T	2: 120,739,977	S1163T	possibly damaging	Het
Ttn	G	A	2: 76,743,530	T23927I	probably damaging	Het
Urb1	G	A	16: 90,810,297	A15V	possibly damaging	Het
Zfp128	C	T	7: 12,890,272	P189L	probably damaging	Het
Zfr	T	C	15: 12,162,182	V806A	probably damaging	Het

Other mutations in Eif3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01087:Eif3b	APN	5	140441107	missense	probably damaging	0.99
IGL01295:Eif3b	APN	5	140441740	missense	possibly damaging	0.77
IGL01539:Eif3b	APN	5	140430253	splice site	probably benign
IGL01897:Eif3b	APN	5	140425447	missense	possibly damaging	0.69
IGL02166:Eif3b	APN	5	140439950	missense	possibly damaging	0.72
IGL02169:Eif3b	APN	5	140430081	missense	possibly damaging	0.92
hangman	UTSW	5	140419837	splice site	probably benign
hemp	UTSW	5	140425322	missense	probably damaging	0.97
R1727:Eif3b	UTSW	5	140425322	missense	probably damaging	0.97
R1909:Eif3b	UTSW	5	140432937	missense	probably damaging	1.00
R2062:Eif3b	UTSW	5	140426453	missense	probably damaging	1.00
R2258:Eif3b	UTSW	5	140427503	missense	possibly damaging	0.79
R4738:Eif3b	UTSW	5	140430078	missense	probably benign	0.01
R4752:Eif3b	UTSW	5	140441101	missense	probably benign	0.08
R4774:Eif3b	UTSW	5	140419500	missense	probably benign
R5342:Eif3b	UTSW	5	140425280	missense	probably damaging	1.00
R5790:Eif3b	UTSW	5	140442131	missense	probably benign	0.42
R6286:Eif3b	UTSW	5	140419811	missense	probably damaging	0.99
R7027:Eif3b	UTSW	5	140425288	missense	probably damaging	0.99
R7293:Eif3b	UTSW	5	140419428	missense	probably benign
R7561:Eif3b	UTSW	5	140442354	missense	probably benign	0.04
R7585:Eif3b	UTSW	5	140440002	missense	probably damaging	1.00
R8170:Eif3b	UTSW	5	140426775	splice site	probably null
R8853:Eif3b	UTSW	5	140440019	missense	probably damaging	0.99
R8864:Eif3b	UTSW	5	140426532	missense	probably benign	0.16
R8958:Eif3b	UTSW	5	140425439	missense	probably benign	0.08
R9286:Eif3b	UTSW	5	140425309	missense	probably benign
Z1177:Eif3b	UTSW	5	140430128	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATCTTGGTACGATCCCATCGCTG -3'
(R):5'- ACTGGTCAACCCTGGAAACCCTTG -3'

Sequencing Primer
(F):5'- CATGCAGGACGCTGAGAAC -3'
(R):5'- GGCCAGGAAACTGGAATGC -3'

Posted On

2013-10-16