Incidental Mutation 'R0783:Eif3b'
ID 76719
Institutional Source Beutler Lab
Gene Symbol Eif3b
Ensembl Gene ENSMUSG00000056076
Gene Name eukaryotic translation initiation factor 3, subunit B
Synonyms Eif3s9, EIF3-P116, D5Wsu45e
MMRRC Submission 038963-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0783 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 140419328-140443360 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 140419837 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000098076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100507]
AlphaFold Q8JZQ9
Predicted Effect probably benign
Transcript: ENSMUST00000100507
SMART Domains Protein: ENSMUSP00000098076
Gene: ENSMUSG00000056076

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
low complexity region 46 59 N/A INTRINSIC
low complexity region 111 128 N/A INTRINSIC
RRM 175 253 4.14e-7 SMART
Blast:WD40 317 350 4e-7 BLAST
Blast:WD40 354 397 2e-7 BLAST
Pfam:eIF2A 496 691 1.3e-68 PFAM
low complexity region 700 719 N/A INTRINSIC
low complexity region 784 797 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.2%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Homozygous embryos die prenatally prior to the blastocyst stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Abi3bp A G 16: 56,595,238 probably null Het
Acsm2 G A 7: 119,573,117 G61D probably damaging Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Bbs9 T C 9: 22,567,714 L151S possibly damaging Het
Camk2g T A 14: 20,744,636 T173S possibly damaging Het
Eif3i A C 4: 129,592,076 F319V possibly damaging Het
Eprs T C 1: 185,398,458 L672P probably damaging Het
Fras1 C T 5: 96,768,430 A3441V probably damaging Het
Gigyf2 T A 1: 87,407,161 M79K probably damaging Het
Grrp1 G A 4: 134,252,057 R37C probably damaging Het
Hdac1 T C 4: 129,518,109 N331S probably benign Het
Hmcn1 C T 1: 150,650,073 G3300S probably damaging Het
Iars2 T C 1: 185,320,874 E400G probably damaging Het
Irx2 T C 13: 72,632,650 probably null Het
Itih4 G A 14: 30,895,423 E567K possibly damaging Het
Klhl5 T A 5: 65,156,253 probably benign Het
Klk8 G A 7: 43,802,197 G204E probably damaging Het
Loxhd1 T C 18: 77,429,984 F1843L possibly damaging Het
Mllt6 T C 11: 97,665,745 V87A probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nhlrc3 A T 3: 53,462,449 S34T probably benign Het
Olfr1099 A G 2: 86,958,562 C299R probably benign Het
Olfr1224-ps1 A T 2: 89,156,891 C95S probably benign Het
Olfr1494 T C 19: 13,749,676 L190P probably damaging Het
Olfr193 A T 16: 59,110,169 L147* probably null Het
Olfr549 A G 7: 102,554,439 I52V probably benign Het
Olfr593 T C 7: 103,212,670 F259S probably damaging Het
Pcnx4 T C 12: 72,575,478 W1074R probably damaging Het
Pcsk9 T C 4: 106,450,117 T310A probably benign Het
Pfas A G 11: 69,000,521 L250P probably damaging Het
Plk5 T A 10: 80,361,130 D352E probably benign Het
Ryr3 A G 2: 112,756,327 probably benign Het
Serinc3 A G 2: 163,637,003 I68T possibly damaging Het
Sez6l2 A G 7: 126,967,145 T810A possibly damaging Het
Tmprss7 G A 16: 45,667,606 Q487* probably null Het
Tnf A G 17: 35,201,674 I56T probably damaging Het
Ttbk2 A T 2: 120,739,977 S1163T possibly damaging Het
Ttn G A 2: 76,743,530 T23927I probably damaging Het
Urb1 G A 16: 90,810,297 A15V possibly damaging Het
Zfp128 C T 7: 12,890,272 P189L probably damaging Het
Zfr T C 15: 12,162,182 V806A probably damaging Het
Other mutations in Eif3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Eif3b APN 5 140441107 missense probably damaging 0.99
IGL01295:Eif3b APN 5 140441740 missense possibly damaging 0.77
IGL01539:Eif3b APN 5 140430253 splice site probably benign
IGL01897:Eif3b APN 5 140425447 missense possibly damaging 0.69
IGL02166:Eif3b APN 5 140439950 missense possibly damaging 0.72
IGL02169:Eif3b APN 5 140430081 missense possibly damaging 0.92
hangman UTSW 5 140419837 splice site probably benign
hemp UTSW 5 140425322 missense probably damaging 0.97
R1727:Eif3b UTSW 5 140425322 missense probably damaging 0.97
R1909:Eif3b UTSW 5 140432937 missense probably damaging 1.00
R2062:Eif3b UTSW 5 140426453 missense probably damaging 1.00
R2258:Eif3b UTSW 5 140427503 missense possibly damaging 0.79
R4738:Eif3b UTSW 5 140430078 missense probably benign 0.01
R4752:Eif3b UTSW 5 140441101 missense probably benign 0.08
R4774:Eif3b UTSW 5 140419500 missense probably benign
R5342:Eif3b UTSW 5 140425280 missense probably damaging 1.00
R5790:Eif3b UTSW 5 140442131 missense probably benign 0.42
R6286:Eif3b UTSW 5 140419811 missense probably damaging 0.99
R7027:Eif3b UTSW 5 140425288 missense probably damaging 0.99
R7293:Eif3b UTSW 5 140419428 missense probably benign
R7561:Eif3b UTSW 5 140442354 missense probably benign 0.04
R7585:Eif3b UTSW 5 140440002 missense probably damaging 1.00
R8170:Eif3b UTSW 5 140426775 splice site probably null
R8853:Eif3b UTSW 5 140440019 missense probably damaging 0.99
R8864:Eif3b UTSW 5 140426532 missense probably benign 0.16
R8958:Eif3b UTSW 5 140425439 missense probably benign 0.08
R9286:Eif3b UTSW 5 140425309 missense probably benign
Z1177:Eif3b UTSW 5 140430128 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTTGGTACGATCCCATCGCTG -3'
(R):5'- ACTGGTCAACCCTGGAAACCCTTG -3'

Sequencing Primer
(F):5'- CATGCAGGACGCTGAGAAC -3'
(R):5'- GGCCAGGAAACTGGAATGC -3'
Posted On 2013-10-16