Incidental Mutation 'R0783:Hdac1'
ID 76714
Institutional Source Beutler Lab
Gene Symbol Hdac1
Ensembl Gene ENSMUSG00000028800
Gene Name histone deacetylase 1
Synonyms HD1, MommeD5, RPD3
MMRRC Submission 038963-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0783 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 129516104-129542713 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 129518109 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 331 (N331S)
Ref Sequence ENSEMBL: ENSMUSP00000099657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062356] [ENSMUST00000102597]
AlphaFold O09106
Predicted Effect probably benign
Transcript: ENSMUST00000062356
SMART Domains Protein: ENSMUSP00000055637
Gene: ENSMUSG00000047945

DomainStartEndE-ValueType
Pfam:MARCKS 2 48 1.8e-11 PFAM
Pfam:MARCKS 42 200 1.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102597
AA Change: N331S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099657
Gene: ENSMUSG00000028800
AA Change: N331S

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 18 320 5.3e-86 PFAM
low complexity region 390 402 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 443 471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150105
Meta Mutation Damage Score 0.0870 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histone acetylation and deacetylation, catalyzed by multisubunit complexes, play a key role in the regulation of eukaryotic gene expression. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family and is a component of the histone deacetylase complex. It also interacts with retinoblastoma tumor-suppressor protein and this complex is a key element in the control of cell proliferation and differentiation. Together with metastasis-associated protein-2, it deacetylates p53 and modulates its effect on cell growth and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos between E9.5 and E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Abi3bp A G 16: 56,595,238 probably null Het
Acsm2 G A 7: 119,573,117 G61D probably damaging Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Bbs9 T C 9: 22,567,714 L151S possibly damaging Het
Camk2g T A 14: 20,744,636 T173S possibly damaging Het
Eif3b T C 5: 140,419,837 probably benign Het
Eif3i A C 4: 129,592,076 F319V possibly damaging Het
Eprs T C 1: 185,398,458 L672P probably damaging Het
Fras1 C T 5: 96,768,430 A3441V probably damaging Het
Gigyf2 T A 1: 87,407,161 M79K probably damaging Het
Grrp1 G A 4: 134,252,057 R37C probably damaging Het
Hmcn1 C T 1: 150,650,073 G3300S probably damaging Het
Iars2 T C 1: 185,320,874 E400G probably damaging Het
Irx2 T C 13: 72,632,650 probably null Het
Itih4 G A 14: 30,895,423 E567K possibly damaging Het
Klhl5 T A 5: 65,156,253 probably benign Het
Klk8 G A 7: 43,802,197 G204E probably damaging Het
Loxhd1 T C 18: 77,429,984 F1843L possibly damaging Het
Mllt6 T C 11: 97,665,745 V87A probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nhlrc3 A T 3: 53,462,449 S34T probably benign Het
Olfr1099 A G 2: 86,958,562 C299R probably benign Het
Olfr1224-ps1 A T 2: 89,156,891 C95S probably benign Het
Olfr1494 T C 19: 13,749,676 L190P probably damaging Het
Olfr193 A T 16: 59,110,169 L147* probably null Het
Olfr549 A G 7: 102,554,439 I52V probably benign Het
Olfr593 T C 7: 103,212,670 F259S probably damaging Het
Pcnx4 T C 12: 72,575,478 W1074R probably damaging Het
Pcsk9 T C 4: 106,450,117 T310A probably benign Het
Pfas A G 11: 69,000,521 L250P probably damaging Het
Plk5 T A 10: 80,361,130 D352E probably benign Het
Ryr3 A G 2: 112,756,327 probably benign Het
Serinc3 A G 2: 163,637,003 I68T possibly damaging Het
Sez6l2 A G 7: 126,967,145 T810A possibly damaging Het
Tmprss7 G A 16: 45,667,606 Q487* probably null Het
Tnf A G 17: 35,201,674 I56T probably damaging Het
Ttbk2 A T 2: 120,739,977 S1163T possibly damaging Het
Ttn G A 2: 76,743,530 T23927I probably damaging Het
Urb1 G A 16: 90,810,297 A15V possibly damaging Het
Zfp128 C T 7: 12,890,272 P189L probably damaging Het
Zfr T C 15: 12,162,182 V806A probably damaging Het
Other mutations in Hdac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03169:Hdac1 APN 4 129518831 missense probably null 0.08
R1771:Hdac1 UTSW 4 129521428 missense probably damaging 1.00
R1985:Hdac1 UTSW 4 129528960 missense possibly damaging 0.86
R2119:Hdac1 UTSW 4 129522364 missense probably benign 0.00
R2175:Hdac1 UTSW 4 129534670 missense probably damaging 1.00
R2415:Hdac1 UTSW 4 129522961 critical splice donor site probably null
R3809:Hdac1 UTSW 4 129524320 missense probably damaging 1.00
R5243:Hdac1 UTSW 4 129516853 intron probably benign
R5276:Hdac1 UTSW 4 129528923 splice site probably null
R6274:Hdac1 UTSW 4 129519109 missense probably damaging 1.00
R6843:Hdac1 UTSW 4 129542590 missense probably damaging 1.00
R7599:Hdac1 UTSW 4 129517466 nonsense probably null
R7816:Hdac1 UTSW 4 129518095 missense probably damaging 0.99
R9169:Hdac1 UTSW 4 129534706 missense probably damaging 1.00
Z1176:Hdac1 UTSW 4 129542616 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AAGTTCTCAAAGAGACGCTGCCTAC -3'
(R):5'- AAGCTCTTGGCCGCAGAAAGAC -3'

Sequencing Primer
(F):5'- AGACGCTGCCTACAGGAG -3'
(R):5'- CTTGGCCGCAGAAAGACTTTATC -3'
Posted On 2013-10-16