Mutagenetix > Incidental Mutation

Incidental Mutation 'R0783:Sez6l2'

76725

Institutional Source

Beutler Lab

Gene Symbol

Sez6l2

Ensembl Gene

ENSMUSG00000030683

Gene Name

seizure related 6 homolog like 2

Synonyms

Psk1

MMRRC Submission

038963-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0783 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126950563-126970606 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 126967145 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 810 (T810A)

Ref Sequence

ENSEMBL: ENSMUSP00000101942 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106332] [ENSMUST00000106333] [ENSMUST00000106335]

AlphaFold

Q4V9Z5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106332
AA Change: T750A

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000101939
Gene: ENSMUSG00000030683
AA Change: T750A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	70	86	N/A	INTRINSIC
low complexity region	93	108	N/A	INTRINSIC
CUB	113	226	8.25e-4	SMART
CCP	230	285	3.75e-15	SMART
CUB	289	399	1.3e-3	SMART
CCP	404	463	8.9e-8	SMART
CUB	467	578	3.45e-14	SMART
CCP	584	639	1.18e-12	SMART
CCP	645	704	1.31e-14	SMART
CCP	711	768	2.76e-13	SMART
transmembrane domain	798	820	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106333
AA Change: T810A

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000101940
Gene: ENSMUSG00000030683
AA Change: T810A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	115	146	N/A	INTRINSIC
low complexity region	153	168	N/A	INTRINSIC
CUB	173	286	8.25e-4	SMART
CCP	290	345	3.75e-15	SMART
CUB	349	459	1.3e-3	SMART
CCP	464	523	8.9e-8	SMART
CUB	527	638	3.45e-14	SMART
CCP	644	699	1.18e-12	SMART
CCP	705	764	1.31e-14	SMART
CCP	771	828	2.76e-13	SMART
transmembrane domain	858	880	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106335
AA Change: T810A

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000101942
Gene: ENSMUSG00000030683
AA Change: T810A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	115	146	N/A	INTRINSIC
low complexity region	153	168	N/A	INTRINSIC
CUB	173	286	8.25e-4	SMART
CCP	290	345	3.75e-15	SMART
CUB	349	459	1.3e-3	SMART
CCP	464	523	8.9e-8	SMART
CUB	527	638	3.45e-14	SMART
CCP	644	699	1.18e-12	SMART
CCP	705	764	1.31e-14	SMART
CCP	771	828	2.76e-13	SMART
transmembrane domain	845	867	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134471

Predicted Effect

probably benign
Transcript: ENSMUST00000155138

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180704

Meta Mutation Damage Score

0.0677

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.8%
20x: 92.2%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seizure-related protein that is localized on the cell surface. The gene is located in a region of chromosome 16p11.2 that is thought to contain candidate genes for autism spectrum disorders (ASD), though there is no evidence directly implicating this gene in ASD. Increased expression of this gene has been found in lung cancers, and the protein is therefore considered to be a novel prognostic marker for lung cancer. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no apparent defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	G	A	7: 120,294,157	G1277R	probably damaging	Het
Abi3bp	A	G	16: 56,595,238		probably null	Het
Acsm2	G	A	7: 119,573,117	G61D	probably damaging	Het
Akp3	G	A	1: 87,127,871	G547R	unknown	Het
Bbs9	T	C	9: 22,567,714	L151S	possibly damaging	Het
Camk2g	T	A	14: 20,744,636	T173S	possibly damaging	Het
Eif3b	T	C	5: 140,419,837		probably benign	Het
Eif3i	A	C	4: 129,592,076	F319V	possibly damaging	Het
Eprs	T	C	1: 185,398,458	L672P	probably damaging	Het
Fras1	C	T	5: 96,768,430	A3441V	probably damaging	Het
Gigyf2	T	A	1: 87,407,161	M79K	probably damaging	Het
Grrp1	G	A	4: 134,252,057	R37C	probably damaging	Het
Hdac1	T	C	4: 129,518,109	N331S	probably benign	Het
Hmcn1	C	T	1: 150,650,073	G3300S	probably damaging	Het
Iars2	T	C	1: 185,320,874	E400G	probably damaging	Het
Irx2	T	C	13: 72,632,650		probably null	Het
Itih4	G	A	14: 30,895,423	E567K	possibly damaging	Het
Klhl5	T	A	5: 65,156,253		probably benign	Het
Klk8	G	A	7: 43,802,197	G204E	probably damaging	Het
Loxhd1	T	C	18: 77,429,984	F1843L	possibly damaging	Het
Mllt6	T	C	11: 97,665,745	V87A	probably damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Nhlrc3	A	T	3: 53,462,449	S34T	probably benign	Het
Olfr1099	A	G	2: 86,958,562	C299R	probably benign	Het
Olfr1224-ps1	A	T	2: 89,156,891	C95S	probably benign	Het
Olfr1494	T	C	19: 13,749,676	L190P	probably damaging	Het
Olfr193	A	T	16: 59,110,169	L147*	probably null	Het
Olfr549	A	G	7: 102,554,439	I52V	probably benign	Het
Olfr593	T	C	7: 103,212,670	F259S	probably damaging	Het
Pcnx4	T	C	12: 72,575,478	W1074R	probably damaging	Het
Pcsk9	T	C	4: 106,450,117	T310A	probably benign	Het
Pfas	A	G	11: 69,000,521	L250P	probably damaging	Het
Plk5	T	A	10: 80,361,130	D352E	probably benign	Het
Ryr3	A	G	2: 112,756,327		probably benign	Het
Serinc3	A	G	2: 163,637,003	I68T	possibly damaging	Het
Tmprss7	G	A	16: 45,667,606	Q487*	probably null	Het
Tnf	A	G	17: 35,201,674	I56T	probably damaging	Het
Ttbk2	A	T	2: 120,739,977	S1163T	possibly damaging	Het
Ttn	G	A	2: 76,743,530	T23927I	probably damaging	Het
Urb1	G	A	16: 90,810,297	A15V	possibly damaging	Het
Zfp128	C	T	7: 12,890,272	P189L	probably damaging	Het
Zfr	T	C	15: 12,162,182	V806A	probably damaging	Het

Other mutations in Sez6l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01444:Sez6l2	APN	7	126961883	missense	possibly damaging	0.91
IGL01710:Sez6l2	APN	7	126968216	missense	probably damaging	1.00
IGL02439:Sez6l2	APN	7	126968189	missense	probably damaging	0.99
IGL02752:Sez6l2	APN	7	126953733	missense	probably damaging	1.00
H8786:Sez6l2	UTSW	7	126961783	missense	possibly damaging	0.95
R0989:Sez6l2	UTSW	7	126959844	missense	probably damaging	1.00
R1148:Sez6l2	UTSW	7	126961812	missense	probably damaging	1.00
R1148:Sez6l2	UTSW	7	126961812	missense	probably damaging	1.00
R1493:Sez6l2	UTSW	7	126961812	missense	probably damaging	1.00
R1509:Sez6l2	UTSW	7	126963363	missense	probably damaging	1.00
R1704:Sez6l2	UTSW	7	126958341	missense	probably damaging	1.00
R1817:Sez6l2	UTSW	7	126967119	missense	probably damaging	1.00
R1889:Sez6l2	UTSW	7	126953496	missense	probably damaging	1.00
R2509:Sez6l2	UTSW	7	126953772	missense	probably benign	0.31
R3772:Sez6l2	UTSW	7	126959203	missense	probably damaging	0.99
R4466:Sez6l2	UTSW	7	126959851	missense	probably damaging	0.97
R4869:Sez6l2	UTSW	7	126961842	missense	probably benign	0.02
R5155:Sez6l2	UTSW	7	126962373	missense	probably damaging	0.99
R5416:Sez6l2	UTSW	7	126961886	missense	probably damaging	1.00
R5551:Sez6l2	UTSW	7	126966830	missense	probably damaging	1.00
R5884:Sez6l2	UTSW	7	126970156	unclassified	probably benign
R5903:Sez6l2	UTSW	7	126970133	unclassified	probably benign
R6015:Sez6l2	UTSW	7	126953453	missense	probably damaging	0.97
R6726:Sez6l2	UTSW	7	126968005	missense	probably damaging	0.96
R7094:Sez6l2	UTSW	7	126952924	missense	probably damaging	0.99
R7117:Sez6l2	UTSW	7	126953743	missense	possibly damaging	0.94
R7228:Sez6l2	UTSW	7	126953725	missense	probably damaging	1.00
R7479:Sez6l2	UTSW	7	126963659	missense	probably damaging	1.00
R7502:Sez6l2	UTSW	7	126961743	missense	probably benign	0.26
R8321:Sez6l2	UTSW	7	126958416	missense	probably damaging	0.99
Z1176:Sez6l2	UTSW	7	126958331	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CAAATGCGCCTGTAAGTTTGGGG -3'
(R):5'- TCAGCAGGGTCAGCCATTGTTC -3'

Sequencing Primer
(F):5'- CCTGTAAGTTTGGGGACACC -3'
(R):5'- GTCAGCCATTGTTCTCGAATTCTC -3'

Posted On

2013-10-16