Incidental Mutation 'R0783:Plk5'
Institutional Source Beutler Lab
Gene Symbol Plk5
Ensembl Gene ENSMUSG00000035486
Gene Namepolo like kinase 5
MMRRC Submission 038963-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0783 (G1)
Quality Score183
Status Validated
Chromosomal Location80356459-80365489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80361130 bp
Amino Acid Change Aspartic acid to Glutamic Acid at position 352 (D352E)
Ref Sequence ENSEMBL: ENSMUSP00000100988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039836] [ENSMUST00000105351]
Predicted Effect probably benign
Transcript: ENSMUST00000039836
AA Change: D356E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044400
Gene: ENSMUSG00000035486
AA Change: D356E

low complexity region 4 11 N/A INTRINSIC
S_TKc 27 283 2.41e-90 SMART
Pfam:POLO_box 425 486 4.9e-18 PFAM
low complexity region 583 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105351
AA Change: D352E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100988
Gene: ENSMUSG00000035486
AA Change: D352E

low complexity region 4 11 N/A INTRINSIC
S_TKc 27 279 2.56e-94 SMART
Pfam:POLO_box 420 483 1.6e-17 PFAM
low complexity region 579 592 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152544
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Abi3bp A G 16: 56,595,238 probably null Het
Acsm2 G A 7: 119,573,117 G61D probably damaging Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Bbs9 T C 9: 22,567,714 L151S possibly damaging Het
Camk2g T A 14: 20,744,636 T173S possibly damaging Het
Eif3b T C 5: 140,419,837 probably benign Het
Eif3i A C 4: 129,592,076 F319V possibly damaging Het
Eprs T C 1: 185,398,458 L672P probably damaging Het
Fras1 C T 5: 96,768,430 A3441V probably damaging Het
Gigyf2 T A 1: 87,407,161 M79K probably damaging Het
Grrp1 G A 4: 134,252,057 R37C probably damaging Het
Hdac1 T C 4: 129,518,109 N331S probably benign Het
Hmcn1 C T 1: 150,650,073 G3300S probably damaging Het
Iars2 T C 1: 185,320,874 E400G probably damaging Het
Irx2 T C 13: 72,632,650 probably null Het
Itih4 G A 14: 30,895,423 E567K possibly damaging Het
Klhl5 T A 5: 65,156,253 probably benign Het
Klk8 G A 7: 43,802,197 G204E probably damaging Het
Loxhd1 T C 18: 77,429,984 F1843L possibly damaging Het
Mllt6 T C 11: 97,665,745 V87A probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nhlrc3 A T 3: 53,462,449 S34T probably benign Het
Olfr1099 A G 2: 86,958,562 C299R probably benign Het
Olfr1224-ps1 A T 2: 89,156,891 C95S probably benign Het
Olfr1494 T C 19: 13,749,676 L190P probably damaging Het
Olfr193 A T 16: 59,110,169 L147* probably null Het
Olfr549 A G 7: 102,554,439 I52V probably benign Het
Olfr593 T C 7: 103,212,670 F259S probably damaging Het
Pcnx4 T C 12: 72,575,478 W1074R probably damaging Het
Pcsk9 T C 4: 106,450,117 T310A probably benign Het
Pfas A G 11: 69,000,521 L250P probably damaging Het
Ryr3 A G 2: 112,756,327 probably benign Het
Serinc3 A G 2: 163,637,003 I68T possibly damaging Het
Sez6l2 A G 7: 126,967,145 T810A possibly damaging Het
Tmprss7 G A 16: 45,667,606 Q487* probably null Het
Tnf A G 17: 35,201,674 I56T probably damaging Het
Ttbk2 A T 2: 120,739,977 S1163T possibly damaging Het
Ttn G A 2: 76,743,530 T23927I probably damaging Het
Urb1 G A 16: 90,810,297 A15V possibly damaging Het
Zfp128 C T 7: 12,890,272 P189L probably damaging Het
Zfr T C 15: 12,162,182 V806A probably damaging Het
Other mutations in Plk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Plk5 APN 10 80363167 critical splice donor site probably null
IGL02605:Plk5 APN 10 80363062 missense probably damaging 0.99
R0083:Plk5 UTSW 10 80356662 missense possibly damaging 0.91
R0590:Plk5 UTSW 10 80360223 missense probably damaging 1.00
R1815:Plk5 UTSW 10 80364021 missense probably benign 0.03
R1866:Plk5 UTSW 10 80360569 splice site probably null
R1991:Plk5 UTSW 10 80363102 missense possibly damaging 0.53
R4501:Plk5 UTSW 10 80359471 missense probably benign 0.05
R4580:Plk5 UTSW 10 80360467 missense possibly damaging 0.95
R4731:Plk5 UTSW 10 80358797 missense probably damaging 1.00
R4801:Plk5 UTSW 10 80359304 missense possibly damaging 0.87
R4802:Plk5 UTSW 10 80359304 missense possibly damaging 0.87
R5084:Plk5 UTSW 10 80358889 missense possibly damaging 0.75
R5346:Plk5 UTSW 10 80363108 missense probably damaging 1.00
R5702:Plk5 UTSW 10 80360567 critical splice donor site probably null
R6417:Plk5 UTSW 10 80364072 missense probably benign 0.07
R6548:Plk5 UTSW 10 80363045 missense probably damaging 1.00
R6695:Plk5 UTSW 10 80360201 missense probably benign 0.22
R7989:Plk5 UTSW 10 80364065 missense probably benign 0.00
R8376:Plk5 UTSW 10 80360345 missense probably damaging 0.97
R8746:Plk5 UTSW 10 80358776 missense probably benign 0.03
X0019:Plk5 UTSW 10 80364301 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ctacaggtggagaaactgagg -3'
Posted On2013-10-16