Incidental Mutation 'R0783:Tmprss7'
ID 76736
Institutional Source Beutler Lab
Gene Symbol Tmprss7
Ensembl Gene ENSMUSG00000033177
Gene Name transmembrane serine protease 7
Synonyms matriptase-3, B230219I23Rik, LOC385645
MMRRC Submission 038963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R0783 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 45656315-45693658 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 45667606 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 487 (Q487*)
Ref Sequence ENSEMBL: ENSMUSP00000110209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114562]
AlphaFold Q8BIK6
Predicted Effect probably null
Transcript: ENSMUST00000114562
AA Change: Q487*
SMART Domains Protein: ENSMUSP00000110209
Gene: ENSMUSG00000033177
AA Change: Q487*

DomainStartEndE-ValueType
low complexity region 28 55 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
Pfam:SEA 94 198 4.6e-23 PFAM
CUB 233 346 9.35e-4 SMART
Pfam:CUB 351 454 3e-7 PFAM
LDLa 469 506 5.63e-13 SMART
LDLa 510 541 5.56e-2 SMART
LDLa 544 582 8.95e-7 SMART
Tryp_SPc 591 821 7.17e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170951
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,294,157 G1277R probably damaging Het
Abi3bp A G 16: 56,595,238 probably null Het
Acsm2 G A 7: 119,573,117 G61D probably damaging Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Bbs9 T C 9: 22,567,714 L151S possibly damaging Het
Camk2g T A 14: 20,744,636 T173S possibly damaging Het
Eif3b T C 5: 140,419,837 probably benign Het
Eif3i A C 4: 129,592,076 F319V possibly damaging Het
Eprs T C 1: 185,398,458 L672P probably damaging Het
Fras1 C T 5: 96,768,430 A3441V probably damaging Het
Gigyf2 T A 1: 87,407,161 M79K probably damaging Het
Grrp1 G A 4: 134,252,057 R37C probably damaging Het
Hdac1 T C 4: 129,518,109 N331S probably benign Het
Hmcn1 C T 1: 150,650,073 G3300S probably damaging Het
Iars2 T C 1: 185,320,874 E400G probably damaging Het
Irx2 T C 13: 72,632,650 probably null Het
Itih4 G A 14: 30,895,423 E567K possibly damaging Het
Klhl5 T A 5: 65,156,253 probably benign Het
Klk8 G A 7: 43,802,197 G204E probably damaging Het
Loxhd1 T C 18: 77,429,984 F1843L possibly damaging Het
Mllt6 T C 11: 97,665,745 V87A probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nhlrc3 A T 3: 53,462,449 S34T probably benign Het
Olfr1099 A G 2: 86,958,562 C299R probably benign Het
Olfr1224-ps1 A T 2: 89,156,891 C95S probably benign Het
Olfr1494 T C 19: 13,749,676 L190P probably damaging Het
Olfr193 A T 16: 59,110,169 L147* probably null Het
Olfr549 A G 7: 102,554,439 I52V probably benign Het
Olfr593 T C 7: 103,212,670 F259S probably damaging Het
Pcnx4 T C 12: 72,575,478 W1074R probably damaging Het
Pcsk9 T C 4: 106,450,117 T310A probably benign Het
Pfas A G 11: 69,000,521 L250P probably damaging Het
Plk5 T A 10: 80,361,130 D352E probably benign Het
Ryr3 A G 2: 112,756,327 probably benign Het
Serinc3 A G 2: 163,637,003 I68T possibly damaging Het
Sez6l2 A G 7: 126,967,145 T810A possibly damaging Het
Tnf A G 17: 35,201,674 I56T probably damaging Het
Ttbk2 A T 2: 120,739,977 S1163T possibly damaging Het
Ttn G A 2: 76,743,530 T23927I probably damaging Het
Urb1 G A 16: 90,810,297 A15V possibly damaging Het
Zfp128 C T 7: 12,890,272 P189L probably damaging Het
Zfr T C 15: 12,162,182 V806A probably damaging Het
Other mutations in Tmprss7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tmprss7 APN 16 45663368 missense probably benign
IGL00985:Tmprss7 APN 16 45662322 missense probably damaging 1.00
IGL01115:Tmprss7 APN 16 45660789 missense probably damaging 1.00
IGL01296:Tmprss7 APN 16 45684574 missense probably damaging 0.98
IGL01298:Tmprss7 APN 16 45664175 missense probably benign 0.00
IGL01459:Tmprss7 APN 16 45663343 missense probably benign 0.00
IGL01785:Tmprss7 APN 16 45680634 missense probably damaging 1.00
IGL02313:Tmprss7 APN 16 45681593 missense probably damaging 1.00
IGL02893:Tmprss7 APN 16 45669528 missense possibly damaging 0.65
IGL02940:Tmprss7 APN 16 45656455 missense probably damaging 1.00
IGL03291:Tmprss7 APN 16 45680748 missense probably benign
amalgum UTSW 16 45683510 missense probably benign 0.15
fusion UTSW 16 45690760 missense probably damaging 1.00
steely UTSW 16 45667606 nonsense probably null
P0019:Tmprss7 UTSW 16 45680733 missense probably benign
R0051:Tmprss7 UTSW 16 45673939 missense probably damaging 1.00
R0051:Tmprss7 UTSW 16 45673939 missense probably damaging 1.00
R0092:Tmprss7 UTSW 16 45667596 missense probably damaging 1.00
R0178:Tmprss7 UTSW 16 45690843 missense probably damaging 1.00
R0219:Tmprss7 UTSW 16 45656457 missense probably damaging 1.00
R0332:Tmprss7 UTSW 16 45680638 missense probably benign 0.01
R0607:Tmprss7 UTSW 16 45669551 missense probably damaging 0.97
R0669:Tmprss7 UTSW 16 45677962 nonsense probably null
R1447:Tmprss7 UTSW 16 45680670 missense probably benign
R1538:Tmprss7 UTSW 16 45679390 missense probably benign 0.44
R1564:Tmprss7 UTSW 16 45662153 critical splice donor site probably null
R1912:Tmprss7 UTSW 16 45656548 nonsense probably null
R1932:Tmprss7 UTSW 16 45684593 nonsense probably null
R2257:Tmprss7 UTSW 16 45686333 missense possibly damaging 0.47
R3840:Tmprss7 UTSW 16 45660832 nonsense probably null
R4232:Tmprss7 UTSW 16 45656573 missense probably damaging 1.00
R4332:Tmprss7 UTSW 16 45686327 missense probably benign 0.00
R4685:Tmprss7 UTSW 16 45679348 missense probably benign
R4712:Tmprss7 UTSW 16 45690760 missense probably damaging 1.00
R4822:Tmprss7 UTSW 16 45663316 missense probably damaging 1.00
R5368:Tmprss7 UTSW 16 45660889 missense probably damaging 1.00
R5386:Tmprss7 UTSW 16 45669528 missense possibly damaging 0.65
R5468:Tmprss7 UTSW 16 45656448 missense probably damaging 1.00
R5526:Tmprss7 UTSW 16 45660904 missense probably damaging 1.00
R5719:Tmprss7 UTSW 16 45686430 missense probably damaging 0.99
R6149:Tmprss7 UTSW 16 45673905 nonsense probably null
R6235:Tmprss7 UTSW 16 45658122 missense probably benign 0.03
R6358:Tmprss7 UTSW 16 45669573 missense probably benign 0.00
R6645:Tmprss7 UTSW 16 45690963 missense possibly damaging 0.90
R7187:Tmprss7 UTSW 16 45677954 missense possibly damaging 0.50
R7222:Tmprss7 UTSW 16 45690893 missense probably benign
R7634:Tmprss7 UTSW 16 45663274 missense probably benign 0.00
R7747:Tmprss7 UTSW 16 45683510 missense probably benign 0.15
R7776:Tmprss7 UTSW 16 45667651 missense probably benign 0.03
R7777:Tmprss7 UTSW 16 45660600 splice site probably null
R8222:Tmprss7 UTSW 16 45658098 missense probably damaging 0.99
R8983:Tmprss7 UTSW 16 45660900 missense probably damaging 0.98
R9472:Tmprss7 UTSW 16 45680689 missense probably benign 0.09
T0975:Tmprss7 UTSW 16 45680733 missense probably benign
Z1176:Tmprss7 UTSW 16 45662256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGGGCCATAAAGAATAGCCATGAC -3'
(R):5'- CCCTGGGCTCCAAGACTAGAAATTG -3'

Sequencing Primer
(F):5'- CTCAGCTAAGGAGAGCCTATGC -3'
(R):5'- CATTGTCTTGACTGCATGGAGAAC -3'
Posted On 2013-10-16