Incidental Mutation 'R0830:Ddx39'
ID77493
Institutional Source Beutler Lab
Gene Symbol Ddx39
Ensembl Gene ENSMUSG00000005481
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 39
Synonyms2610307C23Rik, BAT1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R0830 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location83715177-83726892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83719823 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 74 (C74S)
Ref Sequence ENSEMBL: ENSMUSP00000148329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002964] [ENSMUST00000019576] [ENSMUST00000075843] [ENSMUST00000109802] [ENSMUST00000109810] [ENSMUST00000140521] [ENSMUST00000166939] [ENSMUST00000172396] [ENSMUST00000212949]
Predicted Effect probably benign
Transcript: ENSMUST00000002964
SMART Domains Protein: ENSMUSP00000002964
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 167 1.78e-11 SMART
GPS 384 430 2.18e-8 SMART
Pfam:Dicty_CAR 431 703 1.3e-8 PFAM
Pfam:7tm_2 432 672 8.1e-68 PFAM
low complexity region 704 714 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000019576
AA Change: C74S

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000019576
Gene: ENSMUSG00000005481
AA Change: C74S

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075843
SMART Domains Protein: ENSMUSP00000075240
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 165 213 1.38e-8 SMART
EGF_CA 214 261 1.78e-11 SMART
GPS 478 524 2.18e-8 SMART
Pfam:Dicty_CAR 525 798 4.6e-8 PFAM
Pfam:7tm_2 526 766 5.3e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109802
SMART Domains Protein: ENSMUSP00000105427
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 168 1.38e-8 SMART
EGF_CA 169 216 1.78e-11 SMART
GPS 433 479 2.18e-8 SMART
Pfam:Dicty_CAR 480 752 5.3e-8 PFAM
Pfam:7tm_2 481 721 7.5e-67 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109810
AA Change: C74S

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105435
Gene: ENSMUSG00000005481
AA Change: C74S

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139797
Predicted Effect probably benign
Transcript: ENSMUST00000140521
AA Change: C74S

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116101
Gene: ENSMUSG00000005481
AA Change: C74S

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 208 2.82e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166939
SMART Domains Protein: ENSMUSP00000128220
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EGF 28 66 1.63e1 SMART
EGF_CA 67 117 5.92e-8 SMART
EGF_CA 118 165 1.78e-11 SMART
GPS 382 428 2.18e-8 SMART
Pfam:Dicty_CAR 429 701 2.1e-7 PFAM
Pfam:7tm_2 430 670 1.7e-66 PFAM
low complexity region 702 712 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172396
AA Change: C74S

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132222
Gene: ENSMUSG00000005481
AA Change: C74S

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184114
Predicted Effect possibly damaging
Transcript: ENSMUST00000212949
AA Change: C74S

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. These proteins are characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD) and are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene is thought to play a role in the prognosis of patients with gastrointestinal stromal tumors. A pseudogene of this gene is present on chromosome 13. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,427 R145H probably damaging Het
2410089E03Rik T A 15: 8,247,185 V2771E unknown Het
Adam26a C T 8: 43,568,402 V684I probably benign Het
Alk T C 17: 72,603,200 I170M probably benign Het
Apc2 T C 10: 80,315,405 Y2069H probably damaging Het
Aspm A G 1: 139,474,254 T1219A probably damaging Het
Bnip1 T C 17: 26,789,705 S94P probably benign Het
Cftr A G 6: 18,270,225 I805V probably benign Het
Col25a1 T A 3: 130,584,726 D609E probably damaging Het
Cyp2g1 A G 7: 26,814,791 K274R probably benign Het
D5Ertd579e G A 5: 36,613,757 T1098I probably damaging Het
E2f3 C T 13: 29,985,560 A37T probably benign Het
Emilin2 A G 17: 71,273,820 M637T probably benign Het
Exosc7 T C 9: 123,119,293 L93P probably benign Het
F2 T C 2: 91,630,200 E316G probably benign Het
Fat4 A C 3: 38,999,109 Q4084P probably benign Het
Flywch1 T C 17: 23,762,370 K160E probably benign Het
Foxi2 A G 7: 135,411,730 T230A probably benign Het
Fthl17a A G X: 85,270,073 N154S possibly damaging Het
Hykk G A 9: 54,937,317 R222Q probably damaging Het
Il18rap T A 1: 40,542,990 V357E probably damaging Het
Ing4 A G 6: 125,043,960 E15G probably damaging Het
Irak1 T C X: 74,016,583 D679G probably damaging Het
Itga1 T C 13: 115,007,032 E321G probably benign Het
Kdelc2 T G 9: 53,390,711 L32R probably damaging Het
Nudt1 T A 5: 140,335,321 probably null Het
Nupl1 A G 14: 60,243,482 F138S probably damaging Het
Olfr122 A T 17: 37,771,913 M87L probably damaging Het
Olfr448 G T 6: 42,896,598 W49L probably benign Het
Pllp T C 8: 94,679,475 Y60C probably damaging Het
Pnpla7 T C 2: 24,997,255 V37A probably damaging Het
Psme4 A G 11: 30,807,797 H310R possibly damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Sash1 C T 10: 8,729,909 V906M probably benign Het
Scn1a A T 2: 66,299,784 I1212K probably damaging Het
Stbd1 A T 5: 92,605,130 S160C probably benign Het
Tex29 T C 8: 11,854,157 V99A probably benign Het
Tg A T 15: 66,725,144 N79I probably damaging Het
Tie1 T C 4: 118,482,663 D389G probably damaging Het
Vmn1r178 A G 7: 23,894,027 T167A possibly damaging Het
Xkr4 C T 1: 3,670,745 G202S possibly damaging Het
Other mutations in Ddx39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02544:Ddx39 APN 8 83722773 missense probably benign 0.03
IGL02712:Ddx39 APN 8 83721757 missense probably benign 0.03
R0038:Ddx39 UTSW 8 83722498 missense probably damaging 1.00
R0038:Ddx39 UTSW 8 83722498 missense probably damaging 1.00
R0051:Ddx39 UTSW 8 83720622 missense possibly damaging 0.83
R0051:Ddx39 UTSW 8 83720622 missense possibly damaging 0.83
R0143:Ddx39 UTSW 8 83720550 missense probably benign 0.22
R0147:Ddx39 UTSW 8 83722476 missense possibly damaging 0.74
R0148:Ddx39 UTSW 8 83722476 missense possibly damaging 0.74
R0392:Ddx39 UTSW 8 83721737 missense probably damaging 0.97
R0426:Ddx39 UTSW 8 83721769 missense probably benign 0.00
R1509:Ddx39 UTSW 8 83719898 missense probably damaging 1.00
R2935:Ddx39 UTSW 8 83720958 missense possibly damaging 0.57
R3082:Ddx39 UTSW 8 83722706 missense possibly damaging 0.57
R4050:Ddx39 UTSW 8 83722234 missense probably benign 0.00
R4647:Ddx39 UTSW 8 83722273 missense probably benign 0.00
R4804:Ddx39 UTSW 8 83721095 missense probably damaging 0.99
R5242:Ddx39 UTSW 8 83721811 missense probably benign 0.01
R5268:Ddx39 UTSW 8 83722321 missense probably benign 0.08
R6598:Ddx39 UTSW 8 83722927 missense probably benign 0.03
R6805:Ddx39 UTSW 8 83723137 missense probably damaging 1.00
R6852:Ddx39 UTSW 8 83723017 missense probably benign 0.03
R7326:Ddx39 UTSW 8 83722471 missense probably benign 0.31
R7559:Ddx39 UTSW 8 83720966 missense possibly damaging 0.82
R7803:Ddx39 UTSW 8 83719600 critical splice donor site probably null
R8103:Ddx39 UTSW 8 83724476 critical splice acceptor site probably null
X0026:Ddx39 UTSW 8 83722330 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGGACTTTCTACTGAAGCCAGAGC -3'
(R):5'- GCAAAACAAGTCAGCAGTCACTGTG -3'

Sequencing Primer
(F):5'- ATCCTTCAGAGGGTATGCTACAC -3'
(R):5'- TTTTATGAGGCCCAAGACTGTACTG -3'
Posted On2013-10-16