Incidental Mutation 'R0830:D5Ertd579e'
ID77479
Institutional Source Beutler Lab
Gene Symbol D5Ertd579e
Ensembl Gene ENSMUSG00000029190
Gene NameDNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R0830 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location36600485-36696024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36613757 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1098 (T1098I)
Ref Sequence ENSEMBL: ENSMUSP00000031091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031091]
Predicted Effect probably damaging
Transcript: ENSMUST00000031091
AA Change: T1098I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031091
Gene: ENSMUSG00000029190
AA Change: T1098I

DomainStartEndE-ValueType
Pfam:DUF4603 23 1303 N/A PFAM
low complexity region 1365 1376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132383
SMART Domains Protein: ENSMUSP00000116548
Gene: ENSMUSG00000029190

DomainStartEndE-ValueType
Pfam:DUF4603 1 1181 N/A PFAM
low complexity region 1243 1254 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140063
SMART Domains Protein: ENSMUSP00000118804
Gene: ENSMUSG00000029190

DomainStartEndE-ValueType
Pfam:DUF4603 23 77 1e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201187
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.0%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,427 R145H probably damaging Het
2410089E03Rik T A 15: 8,247,185 V2771E unknown Het
Adam26a C T 8: 43,568,402 V684I probably benign Het
Alk T C 17: 72,603,200 I170M probably benign Het
Apc2 T C 10: 80,315,405 Y2069H probably damaging Het
Aspm A G 1: 139,474,254 T1219A probably damaging Het
Bnip1 T C 17: 26,789,705 S94P probably benign Het
Cftr A G 6: 18,270,225 I805V probably benign Het
Col25a1 T A 3: 130,584,726 D609E probably damaging Het
Cyp2g1 A G 7: 26,814,791 K274R probably benign Het
Ddx39 T A 8: 83,719,823 C74S possibly damaging Het
E2f3 C T 13: 29,985,560 A37T probably benign Het
Emilin2 A G 17: 71,273,820 M637T probably benign Het
Exosc7 T C 9: 123,119,293 L93P probably benign Het
F2 T C 2: 91,630,200 E316G probably benign Het
Fat4 A C 3: 38,999,109 Q4084P probably benign Het
Flywch1 T C 17: 23,762,370 K160E probably benign Het
Foxi2 A G 7: 135,411,730 T230A probably benign Het
Fthl17a A G X: 85,270,073 N154S possibly damaging Het
Hykk G A 9: 54,937,317 R222Q probably damaging Het
Il18rap T A 1: 40,542,990 V357E probably damaging Het
Ing4 A G 6: 125,043,960 E15G probably damaging Het
Irak1 T C X: 74,016,583 D679G probably damaging Het
Itga1 T C 13: 115,007,032 E321G probably benign Het
Kdelc2 T G 9: 53,390,711 L32R probably damaging Het
Nudt1 T A 5: 140,335,321 probably null Het
Nupl1 A G 14: 60,243,482 F138S probably damaging Het
Olfr122 A T 17: 37,771,913 M87L probably damaging Het
Olfr448 G T 6: 42,896,598 W49L probably benign Het
Pllp T C 8: 94,679,475 Y60C probably damaging Het
Pnpla7 T C 2: 24,997,255 V37A probably damaging Het
Psme4 A G 11: 30,807,797 H310R possibly damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Sash1 C T 10: 8,729,909 V906M probably benign Het
Scn1a A T 2: 66,299,784 I1212K probably damaging Het
Stbd1 A T 5: 92,605,130 S160C probably benign Het
Tex29 T C 8: 11,854,157 V99A probably benign Het
Tg A T 15: 66,725,144 N79I probably damaging Het
Tie1 T C 4: 118,482,663 D389G probably damaging Het
Vmn1r178 A G 7: 23,894,027 T167A possibly damaging Het
Xkr4 C T 1: 3,670,745 G202S possibly damaging Het
Other mutations in D5Ertd579e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:D5Ertd579e APN 5 36618754 missense probably damaging 0.99
IGL01925:D5Ertd579e APN 5 36614284 missense possibly damaging 0.67
IGL01933:D5Ertd579e APN 5 36615756 missense probably benign
IGL02164:D5Ertd579e APN 5 36614959 missense probably damaging 1.00
IGL02399:D5Ertd579e APN 5 36616185 missense probably damaging 1.00
IGL02896:D5Ertd579e APN 5 36613982 missense possibly damaging 0.70
IGL03141:D5Ertd579e APN 5 36613277 missense possibly damaging 0.94
IGL03235:D5Ertd579e APN 5 36618828 splice site probably benign
R0201:D5Ertd579e UTSW 5 36616465 missense probably damaging 1.00
R0377:D5Ertd579e UTSW 5 36604567 missense probably benign 0.12
R0926:D5Ertd579e UTSW 5 36672866 missense probably damaging 1.00
R1350:D5Ertd579e UTSW 5 36613737 missense probably damaging 1.00
R1448:D5Ertd579e UTSW 5 36602739 missense probably benign
R1672:D5Ertd579e UTSW 5 36613277 missense possibly damaging 0.50
R1676:D5Ertd579e UTSW 5 36616109 missense probably benign 0.01
R1693:D5Ertd579e UTSW 5 36614097 missense probably damaging 0.98
R1698:D5Ertd579e UTSW 5 36604530 missense probably benign
R1868:D5Ertd579e UTSW 5 36616427 missense probably damaging 0.99
R1909:D5Ertd579e UTSW 5 36614058 missense probably benign 0.21
R2034:D5Ertd579e UTSW 5 36613538 nonsense probably null
R2080:D5Ertd579e UTSW 5 36616206 missense probably benign 0.01
R2105:D5Ertd579e UTSW 5 36613449 missense probably benign 0.12
R2197:D5Ertd579e UTSW 5 36614793 missense possibly damaging 0.69
R4212:D5Ertd579e UTSW 5 36614479 missense probably damaging 0.99
R4452:D5Ertd579e UTSW 5 36616470 missense probably damaging 1.00
R4626:D5Ertd579e UTSW 5 36614559 missense possibly damaging 0.92
R4804:D5Ertd579e UTSW 5 36629652 splice site probably null
R4898:D5Ertd579e UTSW 5 36614941 missense probably damaging 0.99
R4917:D5Ertd579e UTSW 5 36615816 missense probably damaging 1.00
R4960:D5Ertd579e UTSW 5 36616227 nonsense probably null
R4973:D5Ertd579e UTSW 5 36672905 missense probably benign
R5092:D5Ertd579e UTSW 5 36602703 missense probably benign 0.18
R5474:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5475:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5476:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5477:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5801:D5Ertd579e UTSW 5 36604569 missense probably damaging 1.00
R6019:D5Ertd579e UTSW 5 36629692 missense possibly damaging 0.90
R6184:D5Ertd579e UTSW 5 36629783 missense probably damaging 0.99
R6213:D5Ertd579e UTSW 5 36602634 missense probably damaging 1.00
R6244:D5Ertd579e UTSW 5 36615276 missense probably damaging 0.98
R6276:D5Ertd579e UTSW 5 36604514 missense possibly damaging 0.66
R6285:D5Ertd579e UTSW 5 36615577 missense probably damaging 1.00
R6358:D5Ertd579e UTSW 5 36616236 unclassified probably null
R6875:D5Ertd579e UTSW 5 36604657 intron probably null
R6967:D5Ertd579e UTSW 5 36615756 missense probably benign
R7139:D5Ertd579e UTSW 5 36613976 missense probably damaging 1.00
R7329:D5Ertd579e UTSW 5 36616395 missense probably benign 0.21
R7464:D5Ertd579e UTSW 5 36613785 missense probably damaging 0.99
R7664:D5Ertd579e UTSW 5 36614617 missense probably benign 0.00
R7762:D5Ertd579e UTSW 5 36613381 missense
R8175:D5Ertd579e UTSW 5 36615470 missense probably damaging 1.00
R8217:D5Ertd579e UTSW 5 36614058 missense probably benign 0.00
R8233:D5Ertd579e UTSW 5 36615244 missense probably damaging 0.99
R8281:D5Ertd579e UTSW 5 36613320 missense
RF022:D5Ertd579e UTSW 5 36614662 missense probably damaging 1.00
X0019:D5Ertd579e UTSW 5 36613958 missense probably damaging 1.00
Z1176:D5Ertd579e UTSW 5 36615762 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCGGCAGAATCCCAGTTGCCTC -3'
(R):5'- TGACCCCTGGAAACAGCTTTGCTC -3'

Sequencing Primer
(F):5'- ATCCAGTGATGTCTGAGCAC -3'
(R):5'- GAAGATCCTGGCCTTGAATACTC -3'
Posted On2013-10-16