Incidental Mutation 'R0906:Cyp2c39'
ID83342
Institutional Source Beutler Lab
Gene Symbol Cyp2c39
Ensembl Gene ENSMUSG00000025003
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 39
Synonyms
MMRRC Submission 039064-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0906 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location39510862-39568529 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 39510871 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000025968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025968]
Predicted Effect probably null
Transcript: ENSMUST00000025968
AA Change: M1V
SMART Domains Protein: ENSMUSP00000025968
Gene: ENSMUSG00000025003
AA Change: M1V

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:p450 30 487 1.1e-163 PFAM
Meta Mutation Damage Score 0.8517 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 T A 1: 130,737,693 probably benign Het
Atp7b T C 8: 22,027,826 H332R probably benign Het
Bace2 C T 16: 97,356,941 P47L possibly damaging Het
Dcbld2 A G 16: 58,455,247 E442G probably damaging Het
Gm14496 A G 2: 182,000,515 T660A probably damaging Het
Gm4945 A C 17: 47,042,870 noncoding transcript Het
Gm5065 T C 7: 5,359,829 I153T probably damaging Het
Gm6729 T C 10: 86,540,592 noncoding transcript Het
Golga1 G A 2: 39,047,643 R204W probably damaging Het
Guf1 T C 5: 69,566,386 I348T probably damaging Het
Htra4 T A 8: 25,037,144 I212L probably benign Het
Itih5 G A 2: 10,249,188 R750Q probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nsd1 T C 13: 55,277,590 V1520A probably benign Het
Nuak1 C T 10: 84,375,280 V315I probably damaging Het
Nup205 G T 6: 35,236,892 G1740C probably damaging Het
Olfr398 G C 11: 73,983,859 L250V probably damaging Het
Pclo T C 5: 14,676,686 probably benign Het
Pik3r6 T C 11: 68,536,101 probably benign Het
Pikfyve T A 1: 65,253,397 F1336I probably damaging Het
Pla2r1 A G 2: 60,514,947 I355T possibly damaging Het
Rgs22 A T 15: 36,103,902 probably benign Het
Sec63 T A 10: 42,801,928 M312K probably damaging Het
Slc2a5 T C 4: 150,142,830 I401T probably benign Het
Slc9a8 G T 2: 167,434,867 probably benign Het
Stab1 T C 14: 31,145,249 E1718G probably benign Het
Terb1 A T 8: 104,452,636 I640N probably damaging Het
Tmem217 A G 17: 29,526,516 L80P probably damaging Het
Topbp1 C T 9: 103,328,593 P810L probably benign Het
Ttbk2 G A 2: 120,783,781 R151C probably damaging Het
Vmn2r88 T G 14: 51,418,209 L626R probably damaging Het
Other mutations in Cyp2c39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Cyp2c39 APN 19 39513491 splice site probably benign
IGL01806:Cyp2c39 APN 19 39536820 missense probably damaging 1.00
IGL02158:Cyp2c39 APN 19 39568130 missense probably benign
IGL02219:Cyp2c39 APN 19 39568199 utr 3 prime probably benign
IGL02483:Cyp2c39 APN 19 39536787 missense probably damaging 1.00
IGL02490:Cyp2c39 APN 19 39539002 missense probably damaging 1.00
IGL02597:Cyp2c39 APN 19 39560887 nonsense probably null
IGL03089:Cyp2c39 APN 19 39563851 missense probably benign 0.00
IGL03197:Cyp2c39 APN 19 39566917 missense probably damaging 1.00
IGL03392:Cyp2c39 APN 19 39513323 missense probably benign 0.40
G1citation:Cyp2c39 UTSW 19 39536817 missense probably damaging 0.98
R0086:Cyp2c39 UTSW 19 39510913 missense unknown
R0369:Cyp2c39 UTSW 19 39513635 missense probably damaging 1.00
R0585:Cyp2c39 UTSW 19 39536759 missense probably benign 0.43
R0586:Cyp2c39 UTSW 19 39513490 splice site probably benign
R1613:Cyp2c39 UTSW 19 39539011 missense probably damaging 0.99
R1711:Cyp2c39 UTSW 19 39566891 missense probably damaging 1.00
R1780:Cyp2c39 UTSW 19 39538851 splice site probably benign
R2208:Cyp2c39 UTSW 19 39560961 missense possibly damaging 0.56
R2327:Cyp2c39 UTSW 19 39538953 missense probably benign 0.07
R3431:Cyp2c39 UTSW 19 39536862 missense probably damaging 0.99
R4847:Cyp2c39 UTSW 19 39560896 missense probably damaging 1.00
R4866:Cyp2c39 UTSW 19 39513576 missense probably benign 0.43
R4900:Cyp2c39 UTSW 19 39513576 missense probably benign 0.43
R4974:Cyp2c39 UTSW 19 39563879 missense probably benign 0.25
R5159:Cyp2c39 UTSW 19 39560934 missense possibly damaging 0.96
R5470:Cyp2c39 UTSW 19 39513530 missense possibly damaging 0.54
R5860:Cyp2c39 UTSW 19 39536826 missense probably damaging 1.00
R6013:Cyp2c39 UTSW 19 39513525 missense probably benign 0.03
R6018:Cyp2c39 UTSW 19 39510992 missense probably damaging 1.00
R6230:Cyp2c39 UTSW 19 39536802 missense probably damaging 1.00
R6261:Cyp2c39 UTSW 19 39568019 missense probably damaging 1.00
R6345:Cyp2c39 UTSW 19 39513171 critical splice acceptor site probably null
R6345:Cyp2c39 UTSW 19 39513172 critical splice acceptor site probably null
R6822:Cyp2c39 UTSW 19 39536817 missense probably damaging 0.98
R6925:Cyp2c39 UTSW 19 39513195 missense probably damaging 1.00
R7578:Cyp2c39 UTSW 19 39510956 missense probably damaging 1.00
R7871:Cyp2c39 UTSW 19 39560961 missense possibly damaging 0.56
R8032:Cyp2c39 UTSW 19 39510982 missense probably benign 0.00
R8293:Cyp2c39 UTSW 19 39563967 missense probably benign 0.03
R8393:Cyp2c39 UTSW 19 39536811 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GGTTGCGGAGTTATCTTGCATTTCAAA -3'
(R):5'- GGAGCGCAAGGAATACTTACATTGGTT -3'

Sequencing Primer
(F):5'- GGACATAAGCCTGTACTGTTAACC -3'
(R):5'- ACATTGGTTAAGGATTGGCTGAC -3'
Posted On2013-11-08