Mutagenetix > Incidental Mutations

Incidental Mutation 'R0899:Obox5'

83792

Institutional Source

Beutler Lab

Gene Symbol

Obox5

Ensembl Gene

ENSMUSG00000074366

Gene Name

oocyte specific homeobox 5

Synonyms

MMRRC Submission

039059-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R0899 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

15750131-15759800 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 15758875 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 252 (T252S)

Ref Sequence

ENSEMBL: ENSMUSP00000096400 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098802] [ENSMUST00000173053] [ENSMUST00000173455]

Predicted Effect

probably benign
Transcript: ENSMUST00000098802
AA Change: T252S

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000096400
Gene: ENSMUSG00000074366
AA Change: T252S

Domain	Start	End	E-Value	Type
low complexity region	62	74	N/A	INTRINSIC
HOX	94	156	2e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173053

SMART Domains

Protein: ENSMUSP00000134618
Gene: ENSMUSG00000074366

Domain	Start	End	E-Value	Type
low complexity region	62	74	N/A	INTRINSIC
HOX	94	156	2e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173455

SMART Domains

Protein: ENSMUSP00000134468
Gene: ENSMUSG00000074366

Domain	Start	End	E-Value	Type
low complexity region	62	74	N/A	INTRINSIC
HOX	94	156	2e-17	SMART

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.2%
20x: 93.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	T	C	15: 84,949,258	K442E	probably damaging	Het
Adamts1	G	A	16: 85,798,052	R340*	probably null	Het
Afg3l2	T	C	18: 67,422,977	N428S	possibly damaging	Het
Aqp12	G	A	1: 93,006,610	D70N	probably damaging	Het
Astn1	T	A	1: 158,511,109	C475*	probably null	Het
Atp2b1	G	A	10: 99,017,031		probably null	Het
Cbln2	T	C	18: 86,716,752	S217P	possibly damaging	Het
Ces2h	T	C	8: 105,014,550	L58P	probably damaging	Het
Cfap43	C	T	19: 47,747,994	G1353R	possibly damaging	Het
Crcp	A	G	5: 130,059,831	M91V	probably benign	Het
Cubn	A	G	2: 13,362,328	V1577A	possibly damaging	Het
Dthd1	A	G	5: 62,842,928	H531R	probably benign	Het
Fam120a	G	T	13: 48,885,743	A979E	possibly damaging	Het
Fat2	C	T	11: 55,256,225	G3982S	probably damaging	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Fcnb	T	A	2: 28,076,779	K247N	probably damaging	Het
Gm4763	C	T	7: 24,723,312	R112H	probably benign	Het
Gtf2a1l	A	G	17: 88,668,724	N5S	possibly damaging	Het
Htr3a	T	A	9: 48,901,452	D229V	possibly damaging	Het
Ipo11	A	C	13: 106,900,816	L173*	probably null	Het
Jam3	C	A	9: 27,098,957	G244W	probably damaging	Het
Mrpl52	C	T	14: 54,427,084	R12*	probably null	Het
Myo15	A	G	11: 60,477,185	Y257C	possibly damaging	Het
Myocd	G	A	11: 65,195,192	P215L	possibly damaging	Het
Ndst1	T	C	18: 60,707,882	T243A	probably benign	Het
Oit1	A	G	14: 8,364,863	I16T	probably damaging	Het
Olfr1026	A	G	2: 85,923,387	T40A	probably benign	Het
Olfr790	T	C	10: 129,501,432	F183L	probably damaging	Het
Olfr854	A	C	9: 19,566,547	V276G	probably damaging	Het
Osbpl1a	T	C	18: 12,757,690	S377G	possibly damaging	Het
Pfkl	A	G	10: 78,005,439		probably null	Het
Prdm16	A	T	4: 154,528,909	N20K	probably damaging	Het
Prkd1	A	G	12: 50,385,193	I589T	probably damaging	Het
Scnn1b	G	A	7: 121,917,715	G525S	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Ttn	A	G	2: 76,887,985		probably benign	Het
Wap	T	C	11: 6,636,725	T125A	probably benign	Het
Wdr86	C	T	5: 24,718,007	R229Q	probably benign	Het

Other mutations in Obox5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01151:Obox5	APN	7	15758591	missense	possibly damaging	0.73
IGL02105:Obox5	APN	7	15758575	missense	probably benign	0.10
IGL02590:Obox5	APN	7	15757592	missense	possibly damaging	0.51
IGL02642:Obox5	APN	7	15758047	missense	probably benign	0.01
IGL02700:Obox5	APN	7	15758963	missense	possibly damaging	0.70
IGL03129:Obox5	APN	7	15758759	missense	probably damaging	0.99
R0312:Obox5	UTSW	7	15757560	missense	probably damaging	0.98
R0463:Obox5	UTSW	7	15757646	missense	probably damaging	0.99
R0467:Obox5	UTSW	7	15758007	missense	possibly damaging	0.73
R1574:Obox5	UTSW	7	15758633	missense	probably damaging	0.99
R1574:Obox5	UTSW	7	15758633	missense	probably damaging	0.99
R2017:Obox5	UTSW	7	15758882	missense	probably benign	0.02
R3711:Obox5	UTSW	7	15758788	missense	probably benign	0.33
R4391:Obox5	UTSW	7	15757974	nonsense	probably null
R5217:Obox5	UTSW	7	15757868	splice site	probably null
R5357:Obox5	UTSW	7	15757538	start codon destroyed	probably null	0.94
R5424:Obox5	UTSW	7	15758882	missense	probably benign	0.09
R5559:Obox5	UTSW	7	15757597	missense	probably benign	0.19
R6533:Obox5	UTSW	7	15757607	missense	probably benign	0.14
R7021:Obox5	UTSW	7	15757756	splice site	probably null
R7097:Obox5	UTSW	7	15758807	missense	probably damaging	0.99
R7122:Obox5	UTSW	7	15758807	missense	probably damaging	0.99
R7180:Obox5	UTSW	7	15757924	missense	probably benign	0.00
R7395:Obox5	UTSW	7	15758743	missense	probably damaging	1.00
R7398:Obox5	UTSW	7	15758788	missense	probably benign	0.33
R8111:Obox5	UTSW	7	15758616	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGATTCCATGCCCAAATTCAACTGC -3'
(R):5'- CGAACACCTGTGAGAATGCCACTG -3'

Sequencing Primer
(F):5'- TGCAGCCAGGAATCTTCCC -3'
(R):5'- TGTTGCTTCTACAGATAAGACTGG -3'

Posted On

2013-11-08