Mutagenetix > Incidental Mutations

Incidental Mutation 'R0899:Olfr854'

83797

Institutional Source

Beutler Lab

Gene Symbol

Olfr854

Ensembl Gene

ENSMUSG00000095667

Gene Name

olfactory receptor 854

Synonyms

MOR147-3, GA_x6K02T2PVTD-13313295-13312357

MMRRC Submission

039059-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.279) question?

Stock #

R0899 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

19566435-19567382 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 19566547 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 276 (V276G)

Ref Sequence

ENSEMBL: ENSMUSP00000148270 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072419] [ENSMUST00000212872]

Predicted Effect

probably damaging
Transcript: ENSMUST00000072419
AA Change: V279G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000072248
Gene: ENSMUSG00000095667
AA Change: V279G

Domain	Start	End	E-Value	Type
Pfam:7tm_4	34	311	2.3e-51	PFAM
Pfam:7TM_GPCR_Srsx	38	308	9.6e-7	PFAM
Pfam:7tm_1	44	293	1.9e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212872
AA Change: V276G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.2%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	T	C	15: 84,949,258	K442E	probably damaging	Het
Adamts1	G	A	16: 85,798,052	R340*	probably null	Het
Afg3l2	T	C	18: 67,422,977	N428S	possibly damaging	Het
Aqp12	G	A	1: 93,006,610	D70N	probably damaging	Het
Astn1	T	A	1: 158,511,109	C475*	probably null	Het
Atp2b1	G	A	10: 99,017,031		probably null	Het
Cbln2	T	C	18: 86,716,752	S217P	possibly damaging	Het
Ces2h	T	C	8: 105,014,550	L58P	probably damaging	Het
Cfap43	C	T	19: 47,747,994	G1353R	possibly damaging	Het
Crcp	A	G	5: 130,059,831	M91V	probably benign	Het
Cubn	A	G	2: 13,362,328	V1577A	possibly damaging	Het
Dthd1	A	G	5: 62,842,928	H531R	probably benign	Het
Fam120a	G	T	13: 48,885,743	A979E	possibly damaging	Het
Fat2	C	T	11: 55,256,225	G3982S	probably damaging	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Fcnb	T	A	2: 28,076,779	K247N	probably damaging	Het
Gm4763	C	T	7: 24,723,312	R112H	probably benign	Het
Gtf2a1l	A	G	17: 88,668,724	N5S	possibly damaging	Het
Htr3a	T	A	9: 48,901,452	D229V	possibly damaging	Het
Ipo11	A	C	13: 106,900,816	L173*	probably null	Het
Jam3	C	A	9: 27,098,957	G244W	probably damaging	Het
Mrpl52	C	T	14: 54,427,084	R12*	probably null	Het
Myo15	A	G	11: 60,477,185	Y257C	possibly damaging	Het
Myocd	G	A	11: 65,195,192	P215L	possibly damaging	Het
Ndst1	T	C	18: 60,707,882	T243A	probably benign	Het
Obox5	A	T	7: 15,758,875	T252S	probably benign	Het
Oit1	A	G	14: 8,364,863	I16T	probably damaging	Het
Olfr1026	A	G	2: 85,923,387	T40A	probably benign	Het
Olfr790	T	C	10: 129,501,432	F183L	probably damaging	Het
Osbpl1a	T	C	18: 12,757,690	S377G	possibly damaging	Het
Pfkl	A	G	10: 78,005,439		probably null	Het
Prdm16	A	T	4: 154,528,909	N20K	probably damaging	Het
Prkd1	A	G	12: 50,385,193	I589T	probably damaging	Het
Scnn1b	G	A	7: 121,917,715	G525S	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Ttn	A	G	2: 76,887,985		probably benign	Het
Wap	T	C	11: 6,636,725	T125A	probably benign	Het
Wdr86	C	T	5: 24,718,007	R229Q	probably benign	Het

Other mutations in Olfr854

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00930:Olfr854	APN	9	19567175	missense	probably damaging	1.00
IGL02072:Olfr854	APN	9	19566949	missense	probably benign	0.00
IGL02156:Olfr854	APN	9	19567198	missense	probably damaging	1.00
IGL02187:Olfr854	APN	9	19567097	missense	probably benign	0.16
IGL02252:Olfr854	APN	9	19566971	missense	probably damaging	0.99
R0519:Olfr854	UTSW	9	19566949	missense	probably benign	0.21
R0755:Olfr854	UTSW	9	19567119	missense	possibly damaging	0.94
R1832:Olfr854	UTSW	9	19567196	missense	possibly damaging	0.88
R2115:Olfr854	UTSW	9	19567322	missense	probably benign	0.12
R4326:Olfr854	UTSW	9	19567022	missense	possibly damaging	0.95
R4328:Olfr854	UTSW	9	19567022	missense	possibly damaging	0.95
R4329:Olfr854	UTSW	9	19567022	missense	possibly damaging	0.95
R4379:Olfr854	UTSW	9	19566742	missense	probably benign	0.15
R4381:Olfr854	UTSW	9	19566742	missense	probably benign	0.15
R5576:Olfr854	UTSW	9	19567073	missense	probably benign
R6102:Olfr854	UTSW	9	19567022	missense	possibly damaging	0.87
R7449:Olfr854	UTSW	9	19566866	missense	probably benign	0.06
R7515:Olfr854	UTSW	9	19566653	missense	probably damaging	1.00
R8143:Olfr854	UTSW	9	19567291	missense	probably benign	0.04
Z1176:Olfr854	UTSW	9	19566526	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCAGGGAATGAGTGTCCATCTCC -3'
(R):5'- GCTCAAGTTGGCCTGTTCTGATACC -3'

Sequencing Primer
(F):5'- GAGTGTCCATCTCCTTGACATAGAG -3'
(R):5'- CTGATACCCTCATTGATAACATTCTG -3'

Posted On

2013-11-08