Incidental Mutation 'R0899:Olfr854'
ID 83797
Institutional Source Beutler Lab
Gene Symbol Olfr854
Ensembl Gene ENSMUSG00000095667
Gene Name olfactory receptor 854
Synonyms MOR147-3, GA_x6K02T2PVTD-13313295-13312357
MMRRC Submission 039059-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.446) question?
Stock # R0899 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 19566435-19567382 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 19566547 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 276 (V276G)
Ref Sequence ENSEMBL: ENSMUSP00000148270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072419] [ENSMUST00000212872]
AlphaFold Q8VFF1
Predicted Effect probably damaging
Transcript: ENSMUST00000072419
AA Change: V279G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072248
Gene: ENSMUSG00000095667
AA Change: V279G

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.3e-51 PFAM
Pfam:7TM_GPCR_Srsx 38 308 9.6e-7 PFAM
Pfam:7tm_1 44 293 1.9e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212872
AA Change: V276G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,949,258 K442E probably damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Afg3l2 T C 18: 67,422,977 N428S possibly damaging Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
Astn1 T A 1: 158,511,109 C475* probably null Het
Atp2b1 G A 10: 99,017,031 probably null Het
Cbln2 T C 18: 86,716,752 S217P possibly damaging Het
Ces2h T C 8: 105,014,550 L58P probably damaging Het
Cfap43 C T 19: 47,747,994 G1353R possibly damaging Het
Crcp A G 5: 130,059,831 M91V probably benign Het
Cubn A G 2: 13,362,328 V1577A possibly damaging Het
Dthd1 A G 5: 62,842,928 H531R probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fat2 C T 11: 55,256,225 G3982S probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fcnb T A 2: 28,076,779 K247N probably damaging Het
Gm4763 C T 7: 24,723,312 R112H probably benign Het
Gtf2a1l A G 17: 88,668,724 N5S Het
Htr3a T A 9: 48,901,452 D229V possibly damaging Het
Ipo11 A C 13: 106,900,816 L173* probably null Het
Jam3 C A 9: 27,098,957 G244W probably damaging Het
Mrpl52 C T 14: 54,427,084 R12* probably null Het
Myo15 A G 11: 60,477,185 Y257C possibly damaging Het
Myocd G A 11: 65,195,192 P215L possibly damaging Het
Ndst1 T C 18: 60,707,882 T243A probably benign Het
Obox5 A T 7: 15,758,875 T252S probably benign Het
Oit1 A G 14: 8,364,863 I16T probably damaging Het
Olfr1026 A G 2: 85,923,387 T40A probably benign Het
Olfr790 T C 10: 129,501,432 F183L probably damaging Het
Osbpl1a T C 18: 12,757,690 S377G possibly damaging Het
Pfkl A G 10: 78,005,439 probably null Het
Prdm16 A T 4: 154,528,909 N20K probably damaging Het
Prkd1 A G 12: 50,385,193 I589T probably damaging Het
Scnn1b G A 7: 121,917,715 G525S probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn A G 2: 76,887,985 probably benign Het
Wap T C 11: 6,636,725 T125A probably benign Het
Wdr86 C T 5: 24,718,007 R229Q probably benign Het
Other mutations in Olfr854
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Olfr854 APN 9 19567175 missense probably damaging 1.00
IGL02072:Olfr854 APN 9 19566949 missense probably benign 0.00
IGL02156:Olfr854 APN 9 19567198 missense probably damaging 1.00
IGL02187:Olfr854 APN 9 19567097 missense probably benign 0.16
IGL02252:Olfr854 APN 9 19566971 missense probably damaging 0.99
R0519:Olfr854 UTSW 9 19566949 missense probably benign 0.21
R0755:Olfr854 UTSW 9 19567119 missense possibly damaging 0.94
R1832:Olfr854 UTSW 9 19567196 missense possibly damaging 0.88
R2115:Olfr854 UTSW 9 19567322 missense probably benign 0.12
R4326:Olfr854 UTSW 9 19567022 missense possibly damaging 0.95
R4328:Olfr854 UTSW 9 19567022 missense possibly damaging 0.95
R4329:Olfr854 UTSW 9 19567022 missense possibly damaging 0.95
R4379:Olfr854 UTSW 9 19566742 missense probably benign 0.15
R4381:Olfr854 UTSW 9 19566742 missense probably benign 0.15
R5576:Olfr854 UTSW 9 19567073 missense probably benign
R6102:Olfr854 UTSW 9 19567022 missense possibly damaging 0.87
R7449:Olfr854 UTSW 9 19566866 missense probably benign 0.06
R7515:Olfr854 UTSW 9 19566653 missense probably damaging 1.00
R8143:Olfr854 UTSW 9 19567291 missense probably benign 0.04
R8813:Olfr854 UTSW 9 19566599 missense probably damaging 1.00
R9515:Olfr854 UTSW 9 19567100 missense possibly damaging 0.74
Z1176:Olfr854 UTSW 9 19566526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGGGAATGAGTGTCCATCTCC -3'
(R):5'- GCTCAAGTTGGCCTGTTCTGATACC -3'

Sequencing Primer
(F):5'- GAGTGTCCATCTCCTTGACATAGAG -3'
(R):5'- CTGATACCCTCATTGATAACATTCTG -3'
Posted On 2013-11-08