Incidental Mutation 'R0899:Crcp'
ID83788
Institutional Source Beutler Lab
Gene Symbol Crcp
Ensembl Gene ENSMUSG00000025532
Gene Namecalcitonin gene-related peptide-receptor component protein
Synonyms
MMRRC Submission 039059-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R0899 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location130029290-130060789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130059831 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 91 (M91V)
Ref Sequence ENSEMBL: ENSMUSP00000143969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026608] [ENSMUST00000202163] [ENSMUST00000202756]
Predicted Effect probably benign
Transcript: ENSMUST00000026608
AA Change: M142V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026608
Gene: ENSMUSG00000025532
AA Change: M142V

DomainStartEndE-ValueType
RPOL4c 1 127 9.32e-62 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201777
Predicted Effect probably benign
Transcript: ENSMUST00000202163
SMART Domains Protein: ENSMUSP00000144624
Gene: ENSMUSG00000025532

DomainStartEndE-ValueType
Blast:RPOL4c 1 47 2e-26 BLAST
low complexity region 48 59 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202691
Predicted Effect probably benign
Transcript: ENSMUST00000202756
AA Change: M91V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143969
Gene: ENSMUSG00000025532
AA Change: M91V

DomainStartEndE-ValueType
RPOL4c 1 76 6.5e-8 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein that functions as part of a receptor complex for a small neuropeptide that increases intracellular cAMP levels. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,949,258 K442E probably damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Afg3l2 T C 18: 67,422,977 N428S possibly damaging Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
Astn1 T A 1: 158,511,109 C475* probably null Het
Atp2b1 G A 10: 99,017,031 probably null Het
Cbln2 T C 18: 86,716,752 S217P possibly damaging Het
Ces2h T C 8: 105,014,550 L58P probably damaging Het
Cfap43 C T 19: 47,747,994 G1353R possibly damaging Het
Cubn A G 2: 13,362,328 V1577A possibly damaging Het
Dthd1 A G 5: 62,842,928 H531R probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fat2 C T 11: 55,256,225 G3982S probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fcnb T A 2: 28,076,779 K247N probably damaging Het
Gm4763 C T 7: 24,723,312 R112H probably benign Het
Gtf2a1l A G 17: 88,668,724 N5S possibly damaging Het
Htr3a T A 9: 48,901,452 D229V possibly damaging Het
Ipo11 A C 13: 106,900,816 L173* probably null Het
Jam3 C A 9: 27,098,957 G244W probably damaging Het
Mrpl52 C T 14: 54,427,084 R12* probably null Het
Myo15 A G 11: 60,477,185 Y257C possibly damaging Het
Myocd G A 11: 65,195,192 P215L possibly damaging Het
Ndst1 T C 18: 60,707,882 T243A probably benign Het
Obox5 A T 7: 15,758,875 T252S probably benign Het
Oit1 A G 14: 8,364,863 I16T probably damaging Het
Olfr1026 A G 2: 85,923,387 T40A probably benign Het
Olfr790 T C 10: 129,501,432 F183L probably damaging Het
Olfr854 A C 9: 19,566,547 V276G probably damaging Het
Osbpl1a T C 18: 12,757,690 S377G possibly damaging Het
Pfkl A G 10: 78,005,439 probably null Het
Prdm16 A T 4: 154,528,909 N20K probably damaging Het
Prkd1 A G 12: 50,385,193 I589T probably damaging Het
Scnn1b G A 7: 121,917,715 G525S probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn A G 2: 76,887,985 probably benign Het
Wap T C 11: 6,636,725 T125A probably benign Het
Wdr86 C T 5: 24,718,007 R229Q probably benign Het
Other mutations in Crcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02005:Crcp APN 5 130042233 missense probably benign 0.33
IGL02475:Crcp APN 5 130059858 utr 3 prime probably benign
R0329:Crcp UTSW 5 130042242 missense possibly damaging 0.50
R3942:Crcp UTSW 5 130034950 critical splice donor site probably null
R4828:Crcp UTSW 5 130059762 missense probably damaging 1.00
R6168:Crcp UTSW 5 130037896 missense probably damaging 1.00
R7887:Crcp UTSW 5 130037870 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACTGTGGATCTTAGATGAGGCCCTG -3'
(R):5'- AGTCATCAAAGCGCCTGACGAG -3'

Sequencing Primer
(F):5'- CTGGCTCAGGACCAAGTG -3'
(R):5'- CCCAAAGCACAAAGATTTCTTTTC -3'
Posted On2013-11-08