Mutagenetix > Incidental Mutation

Incidental Mutation 'R0899:Atp2b1'

83801

Institutional Source

Beutler Lab

Gene Symbol

Atp2b1

Ensembl Gene

ENSMUSG00000019943

Gene Name

ATPase, Ca++ transporting, plasma membrane 1

Synonyms

PMCA1, 2810442I22Rik, E130111D10Rik

MMRRC Submission

039059-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0899 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98914406-99026143 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 99017031 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020107] [ENSMUST00000220104]

AlphaFold

G5E829

Predicted Effect

probably null
Transcript: ENSMUST00000020107

SMART Domains

Protein: ENSMUSP00000020107
Gene: ENSMUSG00000019943

Domain	Start	End	E-Value	Type
Cation_ATPase_N	50	126	1.8e-3	SMART
low complexity region	138	156	N/A	INTRINSIC
Pfam:E1-E2_ATPase	157	312	1.5e-28	PFAM
Pfam:E1-E2_ATPase	348	464	1.4e-13	PFAM
Pfam:HAD	472	806	6.9e-22	PFAM
Pfam:Cation_ATPase	492	614	8.8e-17	PFAM
Pfam:Hydrolase	605	809	5.8e-14	PFAM
Pfam:Hydrolase_3	764	842	7.2e-7	PFAM
transmembrane domain	855	877	N/A	INTRINSIC
Pfam:Cation_ATPase_C	879	1061	1.2e-47	PFAM
low complexity region	1079	1092	N/A	INTRINSIC
Pfam:ATP_Ca_trans_C	1103	1155	7.5e-31	PFAM
low complexity region	1176	1188	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218312

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218419

Predicted Effect

probably null
Transcript: ENSMUST00000218948

Predicted Effect

probably null
Transcript: ENSMUST00000220104

Predicted Effect

probably null
Transcript: ENSMUST00000220124

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.2%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 1. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	T	C	15: 84,949,258	K442E	probably damaging	Het
Adamts1	G	A	16: 85,798,052	R340*	probably null	Het
Afg3l2	T	C	18: 67,422,977	N428S	possibly damaging	Het
Aqp12	G	A	1: 93,006,610	D70N	probably damaging	Het
Astn1	T	A	1: 158,511,109	C475*	probably null	Het
Cbln2	T	C	18: 86,716,752	S217P	possibly damaging	Het
Ces2h	T	C	8: 105,014,550	L58P	probably damaging	Het
Cfap43	C	T	19: 47,747,994	G1353R	possibly damaging	Het
Crcp	A	G	5: 130,059,831	M91V	probably benign	Het
Cubn	A	G	2: 13,362,328	V1577A	possibly damaging	Het
Dthd1	A	G	5: 62,842,928	H531R	probably benign	Het
Fam120a	G	T	13: 48,885,743	A979E	possibly damaging	Het
Fat2	C	T	11: 55,256,225	G3982S	probably damaging	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Fcnb	T	A	2: 28,076,779	K247N	probably damaging	Het
Gm4763	C	T	7: 24,723,312	R112H	probably benign	Het
Gtf2a1l	A	G	17: 88,668,724	N5S		Het
Htr3a	T	A	9: 48,901,452	D229V	possibly damaging	Het
Ipo11	A	C	13: 106,900,816	L173*	probably null	Het
Jam3	C	A	9: 27,098,957	G244W	probably damaging	Het
Mrpl52	C	T	14: 54,427,084	R12*	probably null	Het
Myo15	A	G	11: 60,477,185	Y257C	possibly damaging	Het
Myocd	G	A	11: 65,195,192	P215L	possibly damaging	Het
Ndst1	T	C	18: 60,707,882	T243A	probably benign	Het
Obox5	A	T	7: 15,758,875	T252S	probably benign	Het
Oit1	A	G	14: 8,364,863	I16T	probably damaging	Het
Olfr1026	A	G	2: 85,923,387	T40A	probably benign	Het
Olfr790	T	C	10: 129,501,432	F183L	probably damaging	Het
Olfr854	A	C	9: 19,566,547	V276G	probably damaging	Het
Osbpl1a	T	C	18: 12,757,690	S377G	possibly damaging	Het
Pfkl	A	G	10: 78,005,439		probably null	Het
Prdm16	A	T	4: 154,528,909	N20K	probably damaging	Het
Prkd1	A	G	12: 50,385,193	I589T	probably damaging	Het
Scnn1b	G	A	7: 121,917,715	G525S	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Ttn	A	G	2: 76,887,985		probably benign	Het
Wap	T	C	11: 6,636,725	T125A	probably benign	Het
Wdr86	C	T	5: 24,718,007	R229Q	probably benign	Het

Other mutations in Atp2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Atp2b1	APN	10	99015020	missense	possibly damaging	0.84
IGL00972:Atp2b1	APN	10	99015044	missense	probably damaging	1.00
IGL00977:Atp2b1	APN	10	98986975	missense	possibly damaging	0.88
IGL01154:Atp2b1	APN	10	98996888	missense	probably damaging	1.00
IGL03073:Atp2b1	APN	10	98999851	missense	probably damaging	1.00
IGL03081:Atp2b1	APN	10	98994813	splice site	probably benign
PIT4453001:Atp2b1	UTSW	10	99016978	missense	probably benign	0.00
R0157:Atp2b1	UTSW	10	98999947	missense	probably damaging	0.99
R0200:Atp2b1	UTSW	10	98979814	nonsense	probably null
R0981:Atp2b1	UTSW	10	99015629	missense	probably damaging	1.00
R1163:Atp2b1	UTSW	10	98979851	missense	possibly damaging	0.91
R1569:Atp2b1	UTSW	10	98987326	missense	probably benign	0.02
R1572:Atp2b1	UTSW	10	98994675	missense	probably benign	0.10
R1574:Atp2b1	UTSW	10	98996948	missense	probably damaging	1.00
R1574:Atp2b1	UTSW	10	98996948	missense	probably damaging	1.00
R1721:Atp2b1	UTSW	10	98996888	missense	probably damaging	1.00
R1782:Atp2b1	UTSW	10	99003201	missense	probably benign	0.01
R1840:Atp2b1	UTSW	10	99022929	missense	probably benign	0.00
R1867:Atp2b1	UTSW	10	98996888	missense	probably damaging	1.00
R1868:Atp2b1	UTSW	10	98996888	missense	probably damaging	1.00
R1944:Atp2b1	UTSW	10	99022931	missense	probably damaging	0.97
R1984:Atp2b1	UTSW	10	99014492	missense	possibly damaging	0.95
R2055:Atp2b1	UTSW	10	99014559	missense	probably damaging	1.00
R2325:Atp2b1	UTSW	10	99018895	nonsense	probably null
R2399:Atp2b1	UTSW	10	98999923	missense	probably benign	0.02
R2876:Atp2b1	UTSW	10	98999745	missense	probably damaging	0.96
R3762:Atp2b1	UTSW	10	99009489	missense	probably damaging	1.00
R3776:Atp2b1	UTSW	10	98979869	frame shift	probably null
R3808:Atp2b1	UTSW	10	99003148	missense	possibly damaging	0.74
R3978:Atp2b1	UTSW	10	98996933	splice site	probably null
R4391:Atp2b1	UTSW	10	99003214	missense	probably benign	0.00
R4825:Atp2b1	UTSW	10	99009564	missense	probably damaging	1.00
R5755:Atp2b1	UTSW	10	99003170	missense	probably damaging	1.00
R5755:Atp2b1	UTSW	10	98994809	critical splice donor site	probably null
R6018:Atp2b1	UTSW	10	99010760	missense	probably damaging	1.00
R6179:Atp2b1	UTSW	10	99022829	missense	probably damaging	1.00
R6455:Atp2b1	UTSW	10	99016980	missense	possibly damaging	0.76
R6496:Atp2b1	UTSW	10	99003337	missense	probably damaging	0.98
R6786:Atp2b1	UTSW	10	99016959	missense	probably damaging	1.00
R6814:Atp2b1	UTSW	10	99023015	missense	possibly damaging	0.87
R7034:Atp2b1	UTSW	10	98987310	missense	probably damaging	1.00
R7036:Atp2b1	UTSW	10	98987310	missense	probably damaging	1.00
R7079:Atp2b1	UTSW	10	99018733	missense	probably benign	0.01
R7216:Atp2b1	UTSW	10	98986977	missense	probably benign	0.30
R7510:Atp2b1	UTSW	10	98993896	missense	probably benign	0.01
R7562:Atp2b1	UTSW	10	99022805	splice site	probably null
R7651:Atp2b1	UTSW	10	99016968	missense	probably damaging	0.99
R7739:Atp2b1	UTSW	10	99001365	missense	probably benign	0.01
R8005:Atp2b1	UTSW	10	98994799	missense	probably damaging	1.00
R8111:Atp2b1	UTSW	10	98996924	missense	possibly damaging	0.95
R8904:Atp2b1	UTSW	10	98969004	missense	possibly damaging	0.62
R9419:Atp2b1	UTSW	10	99001316	missense	possibly damaging	0.56
R9495:Atp2b1	UTSW	10	98999798	missense	probably damaging	0.99
R9506:Atp2b1	UTSW	10	99023000	missense	probably benign	0.01
Z1177:Atp2b1	UTSW	10	99018848	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AACGTGTGCTTCCCACAAAGCC -3'
(R):5'- CAATAAGCAAGCGCCATCTTGGAC -3'

Sequencing Primer
(F):5'- TAGCTGCATGACATACATAGCG -3'
(R):5'- ATCTTGGACAAGCCGCC -3'

Posted On

2013-11-08