Incidental Mutation 'R1127:Eml3'
ID96363
Institutional Source Beutler Lab
Gene Symbol Eml3
Ensembl Gene ENSMUSG00000071647
Gene Nameechinoderm microtubule associated protein like 3
Synonyms
MMRRC Submission 039200-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.757) question?
Stock #R1127 (G1)
Quality Score178
Status Not validated
Chromosome19
Chromosomal Location8929552-8941582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8936308 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 43 (T43I)
Ref Sequence ENSEMBL: ENSMUSP00000153061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096241] [ENSMUST00000224272] [ENSMUST00000224642]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096241
AA Change: T405I

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093960
Gene: ENSMUSG00000071647
AA Change: T405I

DomainStartEndE-ValueType
coiled coil region 12 47 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 118 139 N/A INTRINSIC
low complexity region 149 168 N/A INTRINSIC
low complexity region 198 208 N/A INTRINSIC
Pfam:HELP 215 286 5.3e-30 PFAM
WD40 295 344 6.34e-2 SMART
Blast:WD40 347 392 5e-22 BLAST
WD40 395 434 1.56e-1 SMART
WD40 450 487 2.64e2 SMART
WD40 504 543 3.33e-1 SMART
WD40 587 626 2.69e-5 SMART
WD40 670 709 1.7e-2 SMART
WD40 716 755 1.52e-4 SMART
WD40 829 869 1.29e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000224272
AA Change: T404I

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000224642
AA Change: T43I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226096
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 80.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,135,203 D179G probably benign Het
Adh7 C T 3: 138,221,729 A12V probably benign Het
Ankhd1 T A 18: 36,634,346 N1179K probably damaging Het
Ankrd50 T C 3: 38,457,187 T344A probably benign Het
Aplf T C 6: 87,646,291 T269A probably benign Het
C87977 G A 4: 144,207,124 T471I probably damaging Het
Cavin4 T C 4: 48,663,637 S6P probably damaging Het
Ces2g T C 8: 104,967,462 probably null Het
Cyp2c66 A T 19: 39,163,368 N176Y probably damaging Het
Dnah3 T A 7: 119,923,030 D3980V probably damaging Het
Drc7 G T 8: 95,072,788 E530D probably damaging Het
Dst A G 1: 34,275,277 T6434A probably damaging Het
Dtx3l A G 16: 35,938,757 S41P possibly damaging Het
Eef1b2 G A 1: 63,179,457 probably null Het
Fam110b T A 4: 5,799,434 L284Q probably damaging Het
Gm5538 G A 3: 59,751,893 E256K probably benign Het
Gpr33 A C 12: 52,023,469 H262Q probably damaging Het
Igfals T G 17: 24,880,481 L182R probably damaging Het
Lamc1 A G 1: 153,250,459 F496L possibly damaging Het
Mgea5 G A 19: 45,752,155 R914* probably null Het
Muc4 T A 16: 32,750,525 H134Q possibly damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nxn A T 11: 76,274,069 C205* probably null Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Olfr651 C A 7: 104,553,086 H56N possibly damaging Het
Pamr1 A T 2: 102,639,353 I415F possibly damaging Het
Ppp4r4 G A 12: 103,579,068 G200E probably damaging Het
Prdm16 C A 4: 154,528,799 S57I probably damaging Het
Psmd11 A G 11: 80,471,584 K157R possibly damaging Het
Ptprn2 G A 12: 117,212,008 probably null Het
Pus7 G A 5: 23,768,795 H234Y probably benign Het
Rd3l A G 12: 111,980,283 Y20H probably benign Het
Stk31 A G 6: 49,409,207 D160G probably damaging Het
Sycp2 C T 2: 178,374,366 E768K possibly damaging Het
Tango6 T C 8: 106,688,895 V116A probably benign Het
Ttn C T 2: 76,867,230 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Xylb T C 9: 119,383,377 I427T probably damaging Het
Zc3h7a T G 16: 11,139,075 D890A probably damaging Het
Other mutations in Eml3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Eml3 APN 19 8936398 nonsense probably null
IGL01398:Eml3 APN 19 8934234 splice site probably benign
IGL01904:Eml3 APN 19 8936766 splice site probably benign
IGL02557:Eml3 APN 19 8931381 unclassified probably benign
IGL02795:Eml3 APN 19 8933778 missense probably benign 0.43
IGL03160:Eml3 APN 19 8934955 missense probably benign 0.04
IGL03172:Eml3 APN 19 8939179 unclassified probably benign
IGL03376:Eml3 APN 19 8933790 missense probably damaging 1.00
R0063:Eml3 UTSW 19 8938478 missense probably damaging 1.00
R0063:Eml3 UTSW 19 8938478 missense probably damaging 1.00
R0097:Eml3 UTSW 19 8936651 missense probably benign 0.32
R0097:Eml3 UTSW 19 8936651 missense probably benign 0.32
R0599:Eml3 UTSW 19 8939063 missense probably benign 0.14
R0652:Eml3 UTSW 19 8933285 missense probably damaging 1.00
R0827:Eml3 UTSW 19 8938466 missense probably damaging 0.98
R0841:Eml3 UTSW 19 8937685 missense probably benign
R0880:Eml3 UTSW 19 8940915 missense possibly damaging 0.92
R0924:Eml3 UTSW 19 8933311 critical splice donor site probably null
R1156:Eml3 UTSW 19 8934130 missense probably damaging 1.00
R1160:Eml3 UTSW 19 8933250 missense probably benign 0.00
R1427:Eml3 UTSW 19 8933861 missense probably damaging 1.00
R1497:Eml3 UTSW 19 8936369 missense probably damaging 1.00
R1679:Eml3 UTSW 19 8936637 missense probably damaging 0.98
R1931:Eml3 UTSW 19 8937143 missense probably benign 0.43
R2119:Eml3 UTSW 19 8934354 critical splice donor site probably null
R4296:Eml3 UTSW 19 8931409 missense probably damaging 1.00
R5122:Eml3 UTSW 19 8937696 critical splice donor site probably null
R5288:Eml3 UTSW 19 8939274 missense probably damaging 1.00
R5467:Eml3 UTSW 19 8937582 nonsense probably null
R5836:Eml3 UTSW 19 8941295 missense possibly damaging 0.96
R5845:Eml3 UTSW 19 8939218 missense probably damaging 1.00
R5879:Eml3 UTSW 19 8935015 missense possibly damaging 0.77
R5881:Eml3 UTSW 19 8933443 missense probably damaging 1.00
R6011:Eml3 UTSW 19 8939107 missense probably damaging 1.00
R6247:Eml3 UTSW 19 8930949 missense probably benign
R6777:Eml3 UTSW 19 8936722 missense probably benign
R7132:Eml3 UTSW 19 8941028 missense probably benign 0.25
R7169:Eml3 UTSW 19 8933464 missense probably damaging 1.00
R7896:Eml3 UTSW 19 8933807 missense possibly damaging 0.96
R7979:Eml3 UTSW 19 8933807 missense possibly damaging 0.96
R8054:Eml3 UTSW 19 8939050 missense possibly damaging 0.77
X0025:Eml3 UTSW 19 8937439 missense probably damaging 0.96
Z1177:Eml3 UTSW 19 8937561 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- gctctataccttcagcTTTCAACCAGAGCC -3'
(R):5'- TCTCCACTGCCTCACCCATCCACAC -3'

Sequencing Primer
(F):5'- tgggaagtggaggcagg -3'
(R):5'- TCACCCATCCACACCTCAC -3'
Posted On2014-01-05