Phenotypic Mutation 'silver_decerebrate' (pdf version)
Allelesilver_decerebrate
Mutation Type missense
Chromosome9
Coordinate75,164,195 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Myo5a
Gene Name myosin VA
Synonym(s) 9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA
Chromosomal Location 75,071,015-75,223,688 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010864; MGI: 105976

Mapped Yes 
Amino Acid Change Serine changed to Isoleucine
Institutional SourceBeutler Lab
Gene Model not available
PDB Structure Structure of apo-calmodulin bound to unconventional myosin V [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD in Complex with Two Cargos [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: S693I

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000123128)
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: S693I

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000136731)
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: S693I

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000155282)
Meta Mutation Damage Score Not available question?
Is this an essential gene? Probably essential (E-score: 0.954) question?
Phenotypic Category
Phenotypequestion? Literature verified References
behavior/neurological
lethality-postnatal
life span-post-weaning/aging
nervous system
pigmentation
skin/coat/nails
Candidate Explorer Status CE: no linkage results
Single pedigree
Linkage Analysis Data
Penetrance Probably 100% 
Alleles Listed at MGI

All alleles(71) : Gene trapped(2) Spontaneous(52) Chemically induced(17

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75161497 nonsense probably null
IGL00547:Myo5a APN 9 75141453 missense probably benign 0.00
IGL00788:Myo5a APN 9 75168959 missense probably benign 0.15
IGL01327:Myo5a APN 9 75187538 splice site probably benign
IGL01687:Myo5a APN 9 75156249 missense probably benign 0.12
IGL01886:Myo5a APN 9 75169090 splice site probably benign
IGL01945:Myo5a APN 9 75140671 missense probably damaging 1.00
IGL02127:Myo5a APN 9 75212981 missense probably benign 0.12
IGL02137:Myo5a APN 9 75161535 splice site probably null
IGL02183:Myo5a APN 9 75167236 splice site probably benign
IGL02427:Myo5a APN 9 75176618 splice site probably benign
IGL02490:Myo5a APN 9 75136455 missense probably damaging 1.00
IGL02574:Myo5a APN 9 75211147 missense probably benign 0.00
IGL02886:Myo5a APN 9 75151887 splice site probably benign
IGL02961:Myo5a APN 9 75215120 missense probably benign 0.04
IGL03090:Myo5a APN 9 75120833 missense probably damaging 1.00
IGL03119:Myo5a APN 9 75174015 missense probably benign 0.01
IGL03237:Myo5a APN 9 75129994 missense probably damaging 1.00
IGL03296:Myo5a APN 9 75116202 missense probably damaging 1.00
naoki UTSW 9 75161492 missense probably damaging 1.00
new_gray UTSW 9 missense
nut UTSW 9 splice donor site
silver_decerebrate_2 UTSW 9 75211127 missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75130141 splice site probably benign
IGL03050:Myo5a UTSW 9 75146909 splice site probably null
PIT4403001:Myo5a UTSW 9 75217523 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0091:Myo5a UTSW 9 75161492 missense probably damaging 1.00
R0142:Myo5a UTSW 9 75160574 missense probably benign 0.01
R0243:Myo5a UTSW 9 75186123 critical splice donor site probably null
R0395:Myo5a UTSW 9 75193977 missense probably benign 0.39
R0427:Myo5a UTSW 9 75174196 missense probably benign 0.00
R0545:Myo5a UTSW 9 75167037 missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75180112 missense probably benign 0.00
R0601:Myo5a UTSW 9 75174015 missense probably benign 0.01
R1457:Myo5a UTSW 9 75213065 missense probably damaging 0.99
R1510:Myo5a UTSW 9 75171551 missense probably benign
R1548:Myo5a UTSW 9 75171746 missense probably damaging 1.00
R1759:Myo5a UTSW 9 75181993 missense possibly damaging 0.72
R1924:Myo5a UTSW 9 75116207 missense probably damaging 1.00
R1960:Myo5a UTSW 9 75147857 missense probably damaging 1.00
R2050:Myo5a UTSW 9 75146874 missense probably benign 0.01
R2070:Myo5a UTSW 9 75181984 missense probably benign 0.03
R2075:Myo5a UTSW 9 75189918 missense probably benign 0.01
R2148:Myo5a UTSW 9 75180147 missense probably damaging 1.00
R2201:Myo5a UTSW 9 75217943 missense possibly damaging 0.51
R2337:Myo5a UTSW 9 75203801 missense probably damaging 1.00
R2357:Myo5a UTSW 9 75201365 missense probably damaging 0.99
R2392:Myo5a UTSW 9 75209239 missense probably benign 0.02
R2432:Myo5a UTSW 9 75212873 missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75123040 missense probably damaging 1.00
R2568:Myo5a UTSW 9 75151897 missense probably damaging 1.00
R2932:Myo5a UTSW 9 75196136 missense possibly damaging 0.85
R2971:Myo5a UTSW 9 75116202 missense probably damaging 1.00
R4231:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75144171 missense probably benign
R4321:Myo5a UTSW 9 75217530 missense probably damaging 0.99
R4450:Myo5a UTSW 9 75167176 missense probably benign 0.00
R4573:Myo5a UTSW 9 75201297 splice site probably null
R4577:Myo5a UTSW 9 75217545 missense probably damaging 1.00
R4601:Myo5a UTSW 9 75136388 missense probably damaging 1.00
R4690:Myo5a UTSW 9 75153823 missense probably damaging 0.99
R4691:Myo5a UTSW 9 75180156 missense probably damaging 0.99
R4764:Myo5a UTSW 9 75116336 intron probably benign
R4767:Myo5a UTSW 9 75144076 missense probably damaging 0.99
R4811:Myo5a UTSW 9 75141543 critical splice donor site probably null
R4829:Myo5a UTSW 9 75136407 missense probably damaging 1.00
R4863:Myo5a UTSW 9 75217507 missense probably damaging 1.00
R4902:Myo5a UTSW 9 75174078 missense probably benign
R4947:Myo5a UTSW 9 75123048 missense probably damaging 1.00
R5074:Myo5a UTSW 9 75174156 missense probably benign
R5095:Myo5a UTSW 9 75152020 missense probably damaging 1.00
R5095:Myo5a UTSW 9 75184389 nonsense probably null
R5254:Myo5a UTSW 9 75130120 missense probably damaging 1.00
R5267:Myo5a UTSW 9 75152010 missense probably damaging 1.00
R5419:Myo5a UTSW 9 75147897 missense probably damaging 1.00
R5514:Myo5a UTSW 9 75153766 missense probably damaging 1.00
R5629:Myo5a UTSW 9 75203845 missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75171719 missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75167206 missense probably benign 0.02
R5665:Myo5a UTSW 9 75144181 critical splice donor site probably null
R5719:Myo5a UTSW 9 75151931 missense probably damaging 1.00
R5964:Myo5a UTSW 9 75203833 missense probably benign 0.09
R6014:Myo5a UTSW 9 75167207 nonsense probably null
R6344:Myo5a UTSW 9 75160509 missense probably benign 0.09
R6345:Myo5a UTSW 9 75189913 missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75146967 missense probably damaging 0.98
R6712:Myo5a UTSW 9 75212900 missense probably benign 0.12
R6838:Myo5a UTSW 9 75153883 critical splice donor site probably null
R6866:Myo5a UTSW 9 75140688 missense probably damaging 1.00
R6876:Myo5a UTSW 9 75160490 missense probably benign 0.04
R7108:Myo5a UTSW 9 75129992 missense probably damaging 1.00
R7159:Myo5a UTSW 9 75171563 missense probably benign 0.07
R7164:Myo5a UTSW 9 75180153 missense probably benign 0.00
R7219:Myo5a UTSW 9 75120770 missense probably damaging 1.00
R7497:Myo5a UTSW 9 75197701 missense
R7620:Myo5a UTSW 9 75164136 missense probably benign 0.41
R7719:Myo5a UTSW 9 75144084 missense probably benign 0.01
R7810:Myo5a UTSW 9 75160465 missense probably benign 0.09
R7810:Myo5a UTSW 9 75169010 missense probably benign
R7866:Myo5a UTSW 9 75203752 missense probably damaging 1.00
R7939:Myo5a UTSW 9 75189900 missense
R8050:Myo5a UTSW 9 75181946 missense probably damaging 0.99
R8061:Myo5a UTSW 9 75122957 nonsense probably null
R8326:Myo5a UTSW 9 75217989 missense probably damaging 0.98
R8529:Myo5a UTSW 9 75212872 missense probably benign 0.02
X0010:Myo5a UTSW 9 75185905 missense probably damaging 1.00
Z1177:Myo5a UTSW 9 75186036 missense
Mode of Inheritance Autosomal Recessive
Local Stock Embryos
Repository

none

Last Updated 2016-05-13 3:09 PM by Stephen Lyon
Record Created unknown
Record Posted 2008-02-25
Phenotypic Description
The silver decerebrate phenotype was originally found in two ENU-induced G3 littermates. Homozygous mutants exhibit defects in both coat color and behavior, phenotypes which are always associated and therefore presumed to result from a single mutation. The fur, ears, feet and tail of homozygotes are dark gray. Several behavioral phenotypes are distinct in supine versus prone positions. When placed in a supine position, silver decerebrate mutants exhibit opisthotonus (a convulsive arching of the head and neck), abrupt movements of the feet, and have difficulty righting themselves. In the normal prone position, mutants extend all four feet caudally. In either circumstance, all of the digits are splayed.
 
Several regions of the silver decerebrate brain have been subjected to histological analysis, but the results obtained in several experiments are not consistent from one sample to another. In one analysis, holes were found in the basal ganglia, brainstem, and spinal cord, but these pathological changes were not seen in other preparations.
 
Homozygous silver decerebrate mice die at approximately three weeks of age. Due to this lethality, the strain must be maintained as a heterozygous stock. A similar spectrum of phenotypes is observed in dilute lethal and dilute opisthotonus mutants, which contain mutations in the Myo5a gene (1). No gross anatomical deficiencies of the CNS have been observed in dilute lethal mice or dilute opisthotonus (dop) rats (which carry a null allele of Myo5a) (2).

 

Nature of Mutation
Figure 1. Domain structure of myosin Va.  The head domain contains the actin-binding and ATP-binding sites and generates force.  A central neck domain or light-chain binding domain contains six calmodulin binding IQ motifs.  The C-terminal half of myosin Va consists of the coiled coil (CC) segments responsible for myosin heavy chain dimerization and a globular tail domain (GTD) that mediates cargo binding.  The silver decerebrate mutation results in the substitution of serine by isoleucine at amino acid 693 (red asterisk). This image is interactive. Click on the image to view other mutations found in Myo5a (red). Click on the mutations for more specific information.
The silver decerebrate mutation corresponds to a G to T transversion at position 2505 of the Myo5a transcript, in exon 17 of 41 total exons. The mutation results in the substitution of serine by isoleucine at position 693 of the encoded protein (Figure 1).
 
2489 GAGACCATCCGGATCAGCGCAGCAGGGTTTCCC
688  -E--T--I--R--I--S--A--A--G--F--P-
 
The mutated nucleotide is indicated in red lettering.
 
Please see the record for new gray for information about Myo5a.
Illustration of Mutations in
Gene & Protein
Putative Mechanism
The silver decerebrate mutation is a point mutation near the C terminal end of the head domain (aa 1-887) of myosin Va. Interestingly, other alleles of Myo5a resulting in early postnatal death are null alleles (1;3;4). It is therefore predicted that the silver decerebrate mutation probably quite fully and severely inhibits the function of myosin Va, both in skin and brain.
Primers Primers cannot be located by automatic search.
Genotyping
Silver decerebrate 1 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
SD1(F): 5’-ACACACTCATTACAGGATGGGCACAGT -3’
SD1(R): 5’-AGGGCCTTTCTGCTCAGAATGACAAGA -3’
 
PCR program
1) 94°C             3:00
2) 94°C             0:30
3) 60°C             0:30
4) 68°C             0:50
5) repeat steps (2-4) 35X
6) 68°C             3:00
7) 4°C              ∞
 
Primers for sequencing
SD1_seq(F): 5’- CACAGTGCTGGGCAACCCTGTCTTC -3’
SD1_seq(R): 5’- ACTGCTTGCAGAAGGCTCAGTTCCATTG -3’
 
The following sequence of 635 nucleotides (from Genbank genomic region NC_000075 for linear DNA sequence of Myo5α) is amplified:
 
92628                                                    aca cactcattac
92641 aggatgggca cagtgctggg caaccctgtc ttctttattt taaggatgtt cagtggactt
92701 cctggtaaga ctgtagtgtg tcaactggaa gggctatccc cagctcttta tttctactgc
92761 taattatctc tttgctgcta ttttatggag ttttccattt tgatcactgt tccagctttt
92821 gaatgctttg ttttctagtt tatctacttg gctcttgata aaataattta acccttgatg
92881 gcctgggtct tttgtgacct aacagttttt gtttcttcat gcagatttga tgagaagagg
92941 gcagtgcagc agctaagagc atgtggtgtc ctggagacca tccggatcag cgcagcaggg
93001 tttccctcac ggtgagccca ggcttccaat ggaactgagc cttctgcaag cagttcttga
93061 ataataagct catatgggat tcttttctag gtggacttac caagagtttt tcagccggta
93121 ccgggtccta atgaagcaaa aagatgtgct gggagataga aagcaaacgt gcaagaatgt
93181 attagagaaa ctaatattgg tgagaatggt tttcacttaa ctgtttctgg aaaggtcttg
93241 tcattctgag cagaaaggcc ct
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
References
   1.  Searle, A. G. (1952) A lethal allele of dilute in the house mouse, Heredity 6, 395-401.
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsSophie Rutschmann, Celine Eidenschenk, Bruce Beutler
Edit History
2011-01-07 9:26 AM (current)
2010-08-27 10:09 AM
2010-08-27 10:08 AM
2010-08-10 1:54 PM
2010-08-10 1:54 PM
2010-02-03 10:32 AM