Mutagenetix > Incidental Mutation

Incidental Mutation 'R5964:Myo5a'

471957

Institutional Source

Beutler Lab

Gene Symbol

Myo5a

Ensembl Gene

ENSMUSG00000034593

Gene Name

myosin VA

Synonyms

9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA

MMRRC Submission

044149-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R5964 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75071015-75223688 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75203833 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1534 (T1534A)

Ref Sequence

ENSEMBL: ENSMUSP00000116028 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000136731] [ENSMUST00000148144] [ENSMUST00000155282]

AlphaFold

Q99104

PDB Structure

Structure of apo-calmodulin bound to unconventional myosin V [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD in Complex with Two Cargos [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000123128
AA Change: T1534A

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: T1534A

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1364	N/A	INTRINSIC
coiled coil region	1406	1443	N/A	INTRINSIC
DIL	1685	1790	2.47e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130384

SMART Domains

Protein: ENSMUSP00000114803
Gene: ENSMUSG00000034593

Domain	Start	End	E-Value	Type
coiled coil region	95	201	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136604

Predicted Effect

probably benign
Transcript: ENSMUST00000136731
AA Change: T1509A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: T1509A

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1418	N/A	INTRINSIC
DIL	1660	1765	2.47e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000148144
AA Change: T266A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000121158
Gene: ENSMUSG00000034593
AA Change: T266A

Domain	Start	End	E-Value	Type
coiled coil region	71	175	N/A	INTRINSIC
Blast:DIL	275	305	4e-13	BLAST
Blast:DIL	330	355	5e-6	BLAST
DIL	417	522	2.47e-51	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153404

Predicted Effect

probably benign
Transcript: ENSMUST00000155282
AA Change: T1536A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: T1536A

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1339	1445	N/A	INTRINSIC
DIL	1687	1792	2.47e-51	SMART

Meta Mutation Damage Score

0.0737

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

96% (87/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	G	A	3: 89,343,567	Q581*	probably null	Het
Agl	A	G	3: 116,793,774	V44A	probably damaging	Het
Alpk3	T	A	7: 81,092,260	D608E	possibly damaging	Het
Aspm	C	A	1: 139,455,227		probably benign	Het
Bbs2	T	C	8: 94,068,367	N692S	probably benign	Het
Bend4	A	G	5: 67,417,818	I240T	probably benign	Het
Casp8	G	T	1: 58,833,736	R277L	possibly damaging	Het
Ccdc61	A	T	7: 18,900,940	I123N	probably damaging	Het
Ccr9	T	G	9: 123,779,434	I60M	probably benign	Het
Cd163	T	A	6: 124,326,572	W1066R	probably benign	Het
Cd226	A	T	18: 89,207,183	H68L	probably benign	Het
Cdkn3	T	A	14: 46,767,217	C79S	probably null	Het
Cnnm1	A	T	19: 43,469,723	E658V	probably benign	Het
Cog7	T	C	7: 121,956,029	R304G	probably damaging	Het
Cpt1a	T	A	19: 3,365,760	V286E	possibly damaging	Het
Creg2	C	A	1: 39,624,954	R212L	probably benign	Het
Cyp26a1	T	G	19: 37,699,962	S311A	probably damaging	Het
Cyp2b10	T	C	7: 25,926,223	Y484H	probably benign	Het
Cyp3a44	T	A	5: 145,788,467	Y308F	possibly damaging	Het
Dlg5	A	G	14: 24,164,089	V744A	probably benign	Het
Dlgap2	T	A	8: 14,727,128	Y124*	probably null	Het
Dnah3	T	C	7: 119,922,880	D4030G	probably benign	Het
Dnah5	A	G	15: 28,458,584	T4456A	possibly damaging	Het
Dtx2	T	A	5: 136,023,699	V347D	probably benign	Het
Gigyf2	C	T	1: 87,407,167	T294M	probably damaging	Het
Gli3	C	G	13: 15,726,162	S1378*	probably null	Het
Gm884	A	G	11: 103,542,120	S1232P	possibly damaging	Het
Gnao1	G	A	8: 93,966,999	D337N	probably benign	Het
Gp2	T	A	7: 119,449,129	Q422L	probably benign	Het
Ifit1	T	A	19: 34,648,469	M335K	possibly damaging	Het
Ism1	T	C	2: 139,678,757	S30P	probably benign	Het
Itgax	A	G	7: 128,140,447	D677G	probably damaging	Het
Kansl1l	G	A	1: 66,725,922	A442V	probably damaging	Het
Kif13a	T	C	13: 46,771,524	I311M	probably damaging	Het
Lsm14b	T	A	2: 180,031,425	S84R	probably benign	Het
Lzts3	A	G	2: 130,636,288	Y297H	probably damaging	Het
Map4k3	A	G	17: 80,644,762	I205T	probably damaging	Het
Matn2	A	T	15: 34,410,165	N501I	probably damaging	Het
Mctp2	T	C	7: 72,103,177	E776G	probably damaging	Het
Mex3d	A	T	10: 80,382,587	N265K	probably damaging	Het
Ncoa7	T	C	10: 30,704,636	M35V	probably damaging	Het
Nek4	G	A	14: 30,957,079		probably null	Het
Ngrn	T	C	7: 80,261,933		probably null	Het
Nlrp1a	T	A	11: 71,123,020	Q468L	probably benign	Het
Olfr1450	A	C	19: 12,954,531	Q314P	probably benign	Het
Olfr743	T	A	14: 50,534,198	M262K	probably damaging	Het
Phtf2	T	C	5: 20,775,934	D433G	probably damaging	Het
Prdm13	G	A	4: 21,683,852	Q140*	probably null	Het
Prtg	G	A	9: 72,892,254	G778E	probably benign	Het
Pum3	T	C	19: 27,420,051	E308G	probably damaging	Het
Pwp1	T	G	10: 85,882,886	F306V	probably damaging	Het
Rab24	A	T	13: 55,321,576	Y27N	probably damaging	Het
Rnf215	T	C	11: 4,135,898	F126L	probably benign	Het
Samd13	A	T	3: 146,680,696		probably benign	Het
Serac1	T	A	17: 6,065,049	H213L	probably benign	Het
Slc45a3	A	G	1: 131,978,073	E278G	probably damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Slx4	A	T	16: 4,000,951		probably null	Het
Smarca4	C	A	9: 21,647,430	T631K	probably benign	Het
Snx16	C	T	3: 10,434,481	R163Q	possibly damaging	Het
Stk40	T	C	4: 126,128,895	V140A	probably damaging	Het
Tcf12	A	T	9: 71,868,240	D409E	probably damaging	Het
Tgfbr2	G	T	9: 116,110,255	T168K	possibly damaging	Het
Ticam1	G	T	17: 56,271,703	H131N	probably damaging	Het
Ttn	C	A	2: 76,713,511	E31298*	probably null	Het
Ttn	C	A	2: 76,829,888	R7458I	possibly damaging	Het
Usp7	A	G	16: 8,712,102	V133A	possibly damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Wdfy4	T	C	14: 33,106,011	E1118G	probably damaging	Het
Zfp81	G	C	17: 33,336,845	P3A	probably damaging	Het
Znhit6	A	G	3: 145,576,933	K21R	possibly damaging	Het

Other mutations in Myo5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Myo5a	APN	9	75161497	nonsense	probably null
IGL00547:Myo5a	APN	9	75141453	missense	probably benign	0.00
IGL00788:Myo5a	APN	9	75168959	missense	probably benign	0.15
IGL01327:Myo5a	APN	9	75187538	splice site	probably benign
IGL01687:Myo5a	APN	9	75156249	missense	probably benign	0.12
IGL01886:Myo5a	APN	9	75169090	splice site	probably benign
IGL01945:Myo5a	APN	9	75140671	missense	probably damaging	1.00
IGL02127:Myo5a	APN	9	75212981	missense	probably benign	0.12
IGL02137:Myo5a	APN	9	75161535	splice site	probably null
IGL02183:Myo5a	APN	9	75167236	splice site	probably benign
IGL02427:Myo5a	APN	9	75176618	splice site	probably benign
IGL02490:Myo5a	APN	9	75136455	missense	probably damaging	1.00
IGL02574:Myo5a	APN	9	75211147	missense	probably benign	0.00
IGL02886:Myo5a	APN	9	75151887	splice site	probably benign
IGL02961:Myo5a	APN	9	75215120	missense	probably benign	0.04
IGL03090:Myo5a	APN	9	75120833	missense	probably damaging	1.00
IGL03119:Myo5a	APN	9	75174015	missense	probably benign	0.01
IGL03237:Myo5a	APN	9	75129994	missense	probably damaging	1.00
IGL03296:Myo5a	APN	9	75116202	missense	probably damaging	1.00
naoki	UTSW	9	75161492	missense	probably damaging	1.00
new_gray	UTSW	9		missense
nut	UTSW	9		splice donor site
silver_decerebrate	UTSW	9	75164195	missense	probably damaging	1.00
silver_decerebrate_2	UTSW	9	75211126	missense	probably damaging	1.00
IGL02988:Myo5a	UTSW	9	75130141	splice site	probably benign
IGL03050:Myo5a	UTSW	9	75146909	splice site	probably null
PIT4403001:Myo5a	UTSW	9	75217523	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0091:Myo5a	UTSW	9	75161492	missense	probably damaging	1.00
R0142:Myo5a	UTSW	9	75160574	missense	probably benign	0.01
R0243:Myo5a	UTSW	9	75186123	critical splice donor site	probably null
R0395:Myo5a	UTSW	9	75193977	missense	probably benign	0.39
R0427:Myo5a	UTSW	9	75174196	missense	probably benign	0.00
R0545:Myo5a	UTSW	9	75167037	missense	possibly damaging	0.94
R0565:Myo5a	UTSW	9	75180112	missense	probably benign	0.00
R0601:Myo5a	UTSW	9	75174015	missense	probably benign	0.01
R1457:Myo5a	UTSW	9	75213065	missense	probably damaging	0.99
R1510:Myo5a	UTSW	9	75171551	missense	probably benign
R1548:Myo5a	UTSW	9	75171746	missense	probably damaging	1.00
R1759:Myo5a	UTSW	9	75181993	missense	possibly damaging	0.72
R1924:Myo5a	UTSW	9	75116207	missense	probably damaging	1.00
R1960:Myo5a	UTSW	9	75147857	missense	probably damaging	1.00
R2050:Myo5a	UTSW	9	75146874	missense	probably benign	0.01
R2070:Myo5a	UTSW	9	75181984	missense	probably benign	0.03
R2075:Myo5a	UTSW	9	75189918	missense	probably benign	0.01
R2148:Myo5a	UTSW	9	75180147	missense	probably damaging	1.00
R2201:Myo5a	UTSW	9	75217943	missense	possibly damaging	0.51
R2337:Myo5a	UTSW	9	75203801	missense	probably damaging	1.00
R2357:Myo5a	UTSW	9	75201365	missense	probably damaging	0.99
R2392:Myo5a	UTSW	9	75209239	missense	probably benign	0.02
R2432:Myo5a	UTSW	9	75212873	missense	possibly damaging	0.89
R2568:Myo5a	UTSW	9	75123040	missense	probably damaging	1.00
R2568:Myo5a	UTSW	9	75151897	missense	probably damaging	1.00
R2932:Myo5a	UTSW	9	75196136	missense	possibly damaging	0.85
R2971:Myo5a	UTSW	9	75116202	missense	probably damaging	1.00
R4231:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R4293:Myo5a	UTSW	9	75144171	missense	probably benign
R4321:Myo5a	UTSW	9	75217530	missense	probably damaging	0.99
R4450:Myo5a	UTSW	9	75167176	missense	probably benign	0.00
R4573:Myo5a	UTSW	9	75201297	splice site	probably null
R4577:Myo5a	UTSW	9	75217545	missense	probably damaging	1.00
R4601:Myo5a	UTSW	9	75136388	missense	probably damaging	1.00
R4690:Myo5a	UTSW	9	75153823	missense	probably damaging	0.99
R4691:Myo5a	UTSW	9	75180156	missense	probably damaging	0.99
R4764:Myo5a	UTSW	9	75116336	intron	probably benign
R4767:Myo5a	UTSW	9	75144076	missense	probably damaging	0.99
R4811:Myo5a	UTSW	9	75141543	critical splice donor site	probably null
R4829:Myo5a	UTSW	9	75136407	missense	probably damaging	1.00
R4863:Myo5a	UTSW	9	75217507	missense	probably damaging	1.00
R4902:Myo5a	UTSW	9	75174078	missense	probably benign
R4947:Myo5a	UTSW	9	75123048	missense	probably damaging	1.00
R5074:Myo5a	UTSW	9	75174156	missense	probably benign
R5095:Myo5a	UTSW	9	75152020	missense	probably damaging	1.00
R5095:Myo5a	UTSW	9	75184389	nonsense	probably null
R5254:Myo5a	UTSW	9	75130120	missense	probably damaging	1.00
R5267:Myo5a	UTSW	9	75152010	missense	probably damaging	1.00
R5419:Myo5a	UTSW	9	75147897	missense	probably damaging	1.00
R5514:Myo5a	UTSW	9	75153766	missense	probably damaging	1.00
R5629:Myo5a	UTSW	9	75203845	missense	possibly damaging	0.89
R5649:Myo5a	UTSW	9	75171719	missense	possibly damaging	0.92
R5661:Myo5a	UTSW	9	75167206	missense	probably benign	0.02
R5665:Myo5a	UTSW	9	75144181	critical splice donor site	probably null
R5719:Myo5a	UTSW	9	75151931	missense	probably damaging	1.00
R6014:Myo5a	UTSW	9	75167207	nonsense	probably null
R6344:Myo5a	UTSW	9	75160509	missense	probably benign	0.09
R6345:Myo5a	UTSW	9	75189913	missense	possibly damaging	0.77
R6644:Myo5a	UTSW	9	75146967	missense	probably damaging	0.98
R6712:Myo5a	UTSW	9	75212900	missense	probably benign	0.12
R6838:Myo5a	UTSW	9	75153883	critical splice donor site	probably null
R6866:Myo5a	UTSW	9	75140688	missense	probably damaging	1.00
R6876:Myo5a	UTSW	9	75160490	missense	probably benign	0.04
R7108:Myo5a	UTSW	9	75129992	missense	probably damaging	1.00
R7159:Myo5a	UTSW	9	75171563	missense	probably benign	0.07
R7164:Myo5a	UTSW	9	75180153	missense	probably benign	0.00
R7219:Myo5a	UTSW	9	75120770	missense	probably damaging	1.00
R7497:Myo5a	UTSW	9	75197701	missense
R7620:Myo5a	UTSW	9	75164136	missense	probably benign	0.41
R7719:Myo5a	UTSW	9	75144084	missense	probably benign	0.01
R7810:Myo5a	UTSW	9	75160465	missense	probably benign	0.09
R7810:Myo5a	UTSW	9	75169010	missense	probably benign
R7866:Myo5a	UTSW	9	75203752	missense	probably damaging	1.00
R7939:Myo5a	UTSW	9	75189900	missense
R8050:Myo5a	UTSW	9	75181946	missense	probably damaging	0.99
R8061:Myo5a	UTSW	9	75122957	nonsense	probably null
R8326:Myo5a	UTSW	9	75217989	missense	probably damaging	0.98
R8529:Myo5a	UTSW	9	75212872	missense	probably benign	0.02
R8824:Myo5a	UTSW	9	75167046	missense	probably damaging	1.00
R8858:Myo5a	UTSW	9	75184683	missense	probably damaging	0.99
R9040:Myo5a	UTSW	9	75174059	missense	probably benign	0.07
R9092:Myo5a	UTSW	9	75147132	critical splice donor site	probably null
R9249:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R9274:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R9293:Myo5a	UTSW	9	75180030	missense	probably benign	0.37
R9366:Myo5a	UTSW	9	75217518	missense	probably damaging	0.98
R9410:Myo5a	UTSW	9	75116214	missense	probably damaging	0.98
R9644:Myo5a	UTSW	9	75136349	missense	probably damaging	1.00
R9649:Myo5a	UTSW	9	75192444	missense
R9748:Myo5a	UTSW	9	75184683	missense	probably damaging	0.99
R9766:Myo5a	UTSW	9	75171632	missense	probably damaging	0.99
X0010:Myo5a	UTSW	9	75185905	missense	probably damaging	1.00
Z1177:Myo5a	UTSW	9	75186036	missense

Predicted Primers

PCR Primer
(F):5'- GCTCTGAATGATTGAGCTCTTAC -3'
(R):5'- GCTTGTAGATATGCTGAAAGGC -3'

Sequencing Primer
(F):5'- GTGCTTTCATCTCATAAAACATGCC -3'
(R):5'- CTGGAAGGGTTACAGTAGCAAC -3'

Posted On

2017-03-31