Incidental Mutation 'R2971:Myo5a'
ID 265680
Institutional Source Beutler Lab
Gene Symbol Myo5a
Ensembl Gene ENSMUSG00000034593
Gene Name myosin VA
Synonyms 9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA
MMRRC Submission 040525-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock # R2971 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 75071015-75223688 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75116202 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 15 (I15T)
Ref Sequence ENSEMBL: ENSMUSP00000122773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000155282]
AlphaFold Q99104
Predicted Effect probably damaging
Transcript: ENSMUST00000123128
AA Change: I15T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: I15T

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123531
AA Change: I15T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000136731
AA Change: I15T

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: I15T

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149823
Predicted Effect possibly damaging
Transcript: ENSMUST00000155282
AA Change: I15T

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: I15T

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Meta Mutation Damage Score 0.3409 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,699 D1406G possibly damaging Het
Aebp2 T C 6: 140,633,898 probably null Het
Ap5m1 T A 14: 49,083,882 Y49* probably null Het
Atp8b5 T C 4: 43,361,953 probably benign Het
Baz1a A G 12: 54,923,439 S518P probably damaging Het
Ces1c T A 8: 93,104,193 D445V probably benign Het
Ctnnbl1 C T 2: 157,871,186 H464Y probably benign Het
Cyp2j6 T C 4: 96,531,781 K238E probably benign Het
Gdf10 G A 14: 33,924,191 R99H probably damaging Het
Gm4779 G A X: 101,792,962 P116L possibly damaging Het
Gucy2g A G 19: 55,210,276 S812P probably damaging Het
Ifit3b C T 19: 34,612,017 Q198* probably null Het
Irgm1 A T 11: 48,866,590 Y131* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Myh7b A G 2: 155,632,255 N1630S probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nme6 A G 9: 109,842,091 probably benign Het
Olfr1040 T C 2: 86,146,564 T57A probably damaging Het
Olfr741 T A 14: 50,485,608 I50N probably damaging Het
Plch2 T G 4: 154,990,767 M797L probably benign Het
Plscr2 G T 9: 92,290,671 E128* probably null Het
Plxna2 T A 1: 194,797,731 D1403E probably damaging Het
Pou6f2 T C 13: 18,381,967 T25A unknown Het
Psmb11 T C 14: 54,625,343 V6A possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprd T G 4: 76,107,324 S546R probably benign Het
Rbp3 A G 14: 33,954,454 N120D probably benign Het
Skint1 C A 4: 112,021,330 P153H possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Tmem201 A G 4: 149,722,445 probably benign Het
Ube2v1 T C 2: 167,610,336 N89D probably damaging Het
Zfp282 A T 6: 47,897,932 probably null Het
Zfp560 C A 9: 20,348,944 M207I probably benign Het
Zfp697 T C 3: 98,428,301 Y461H probably damaging Het
Other mutations in Myo5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75161497 nonsense probably null
IGL00547:Myo5a APN 9 75141453 missense probably benign 0.00
IGL00788:Myo5a APN 9 75168959 missense probably benign 0.15
IGL01327:Myo5a APN 9 75187538 splice site probably benign
IGL01687:Myo5a APN 9 75156249 missense probably benign 0.12
IGL01886:Myo5a APN 9 75169090 splice site probably benign
IGL01945:Myo5a APN 9 75140671 missense probably damaging 1.00
IGL02127:Myo5a APN 9 75212981 missense probably benign 0.12
IGL02137:Myo5a APN 9 75161535 splice site probably null
IGL02183:Myo5a APN 9 75167236 splice site probably benign
IGL02427:Myo5a APN 9 75176618 splice site probably benign
IGL02490:Myo5a APN 9 75136455 missense probably damaging 1.00
IGL02574:Myo5a APN 9 75211147 missense probably benign 0.00
IGL02886:Myo5a APN 9 75151887 splice site probably benign
IGL02961:Myo5a APN 9 75215120 missense probably benign 0.04
IGL03090:Myo5a APN 9 75120833 missense probably damaging 1.00
IGL03119:Myo5a APN 9 75174015 missense probably benign 0.01
IGL03237:Myo5a APN 9 75129994 missense probably damaging 1.00
IGL03296:Myo5a APN 9 75116202 missense probably damaging 1.00
naoki UTSW 9 75161492 missense probably damaging 1.00
new_gray UTSW 9 missense
nut UTSW 9 splice donor site
silver_decerebrate UTSW 9 75164195 missense probably damaging 1.00
silver_decerebrate_2 UTSW 9 75211127 missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75130141 splice site probably benign
IGL03050:Myo5a UTSW 9 75146909 splice site probably null
PIT4403001:Myo5a UTSW 9 75217523 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0091:Myo5a UTSW 9 75161492 missense probably damaging 1.00
R0142:Myo5a UTSW 9 75160574 missense probably benign 0.01
R0243:Myo5a UTSW 9 75186123 critical splice donor site probably null
R0395:Myo5a UTSW 9 75193977 missense probably benign 0.39
R0427:Myo5a UTSW 9 75174196 missense probably benign 0.00
R0545:Myo5a UTSW 9 75167037 missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75180112 missense probably benign 0.00
R0601:Myo5a UTSW 9 75174015 missense probably benign 0.01
R1457:Myo5a UTSW 9 75213065 missense probably damaging 0.99
R1510:Myo5a UTSW 9 75171551 missense probably benign
R1548:Myo5a UTSW 9 75171746 missense probably damaging 1.00
R1759:Myo5a UTSW 9 75181993 missense possibly damaging 0.72
R1924:Myo5a UTSW 9 75116207 missense probably damaging 1.00
R1960:Myo5a UTSW 9 75147857 missense probably damaging 1.00
R2050:Myo5a UTSW 9 75146874 missense probably benign 0.01
R2070:Myo5a UTSW 9 75181984 missense probably benign 0.03
R2075:Myo5a UTSW 9 75189918 missense probably benign 0.01
R2148:Myo5a UTSW 9 75180147 missense probably damaging 1.00
R2201:Myo5a UTSW 9 75217943 missense possibly damaging 0.51
R2337:Myo5a UTSW 9 75203801 missense probably damaging 1.00
R2357:Myo5a UTSW 9 75201365 missense probably damaging 0.99
R2392:Myo5a UTSW 9 75209239 missense probably benign 0.02
R2432:Myo5a UTSW 9 75212873 missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75123040 missense probably damaging 1.00
R2568:Myo5a UTSW 9 75151897 missense probably damaging 1.00
R2932:Myo5a UTSW 9 75196136 missense possibly damaging 0.85
R4231:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75144171 missense probably benign
R4321:Myo5a UTSW 9 75217530 missense probably damaging 0.99
R4450:Myo5a UTSW 9 75167176 missense probably benign 0.00
R4573:Myo5a UTSW 9 75201297 splice site probably null
R4577:Myo5a UTSW 9 75217545 missense probably damaging 1.00
R4601:Myo5a UTSW 9 75136388 missense probably damaging 1.00
R4690:Myo5a UTSW 9 75153823 missense probably damaging 0.99
R4691:Myo5a UTSW 9 75180156 missense probably damaging 0.99
R4764:Myo5a UTSW 9 75116336 intron probably benign
R4767:Myo5a UTSW 9 75144076 missense probably damaging 0.99
R4811:Myo5a UTSW 9 75141543 critical splice donor site probably null
R4829:Myo5a UTSW 9 75136407 missense probably damaging 1.00
R4863:Myo5a UTSW 9 75217507 missense probably damaging 1.00
R4902:Myo5a UTSW 9 75174078 missense probably benign
R4947:Myo5a UTSW 9 75123048 missense probably damaging 1.00
R5074:Myo5a UTSW 9 75174156 missense probably benign
R5095:Myo5a UTSW 9 75152020 missense probably damaging 1.00
R5095:Myo5a UTSW 9 75184389 nonsense probably null
R5254:Myo5a UTSW 9 75130120 missense probably damaging 1.00
R5267:Myo5a UTSW 9 75152010 missense probably damaging 1.00
R5419:Myo5a UTSW 9 75147897 missense probably damaging 1.00
R5514:Myo5a UTSW 9 75153766 missense probably damaging 1.00
R5629:Myo5a UTSW 9 75203845 missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75171719 missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75167206 missense probably benign 0.02
R5665:Myo5a UTSW 9 75144181 critical splice donor site probably null
R5719:Myo5a UTSW 9 75151931 missense probably damaging 1.00
R5964:Myo5a UTSW 9 75203833 missense probably benign 0.09
R6014:Myo5a UTSW 9 75167207 nonsense probably null
R6344:Myo5a UTSW 9 75160509 missense probably benign 0.09
R6345:Myo5a UTSW 9 75189913 missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75146967 missense probably damaging 0.98
R6712:Myo5a UTSW 9 75212900 missense probably benign 0.12
R6838:Myo5a UTSW 9 75153883 critical splice donor site probably null
R6866:Myo5a UTSW 9 75140688 missense probably damaging 1.00
R6876:Myo5a UTSW 9 75160490 missense probably benign 0.04
R7108:Myo5a UTSW 9 75129992 missense probably damaging 1.00
R7159:Myo5a UTSW 9 75171563 missense probably benign 0.07
R7164:Myo5a UTSW 9 75180153 missense probably benign 0.00
R7219:Myo5a UTSW 9 75120770 missense probably damaging 1.00
R7497:Myo5a UTSW 9 75197701 missense
R7620:Myo5a UTSW 9 75164136 missense probably benign 0.41
R7719:Myo5a UTSW 9 75144084 missense probably benign 0.01
R7810:Myo5a UTSW 9 75160465 missense probably benign 0.09
R7810:Myo5a UTSW 9 75169010 missense probably benign
R7866:Myo5a UTSW 9 75203752 missense probably damaging 1.00
R7939:Myo5a UTSW 9 75189900 missense
R8050:Myo5a UTSW 9 75181946 missense probably damaging 0.99
R8061:Myo5a UTSW 9 75122957 nonsense probably null
R8326:Myo5a UTSW 9 75217989 missense probably damaging 0.98
R8529:Myo5a UTSW 9 75212872 missense probably benign 0.02
R8824:Myo5a UTSW 9 75167046 missense probably damaging 1.00
R8858:Myo5a UTSW 9 75184683 missense probably damaging 0.99
R9040:Myo5a UTSW 9 75174059 missense probably benign 0.07
R9092:Myo5a UTSW 9 75147132 critical splice donor site probably null
R9249:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R9274:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R9293:Myo5a UTSW 9 75180030 missense probably benign 0.37
R9366:Myo5a UTSW 9 75217518 missense probably damaging 0.98
R9410:Myo5a UTSW 9 75116214 missense probably damaging 0.98
X0010:Myo5a UTSW 9 75185905 missense probably damaging 1.00
Z1177:Myo5a UTSW 9 75186036 missense
Predicted Primers PCR Primer
(F):5'- TGGTACTGGGGCTAACCTAC -3'
(R):5'- GGGGTTAGGCAAGTTATAGCAAAATTC -3'

Sequencing Primer
(F):5'- CCCTGGACTATGCAATAAGATGCTG -3'
(R):5'- AGCAAAATTCTATCTTTCACTCTCC -3'
Posted On 2015-02-05