Incidental Mutation 'R2971:Myo5a'
ID 265680
Institutional Source Beutler Lab
Gene Symbol Myo5a
Ensembl Gene ENSMUSG00000034593
Gene Name myosin VA
Synonyms flail, Myo5, MVa, Dbv, 9630007J19Rik, MyoVA
MMRRC Submission 040525-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R2971 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 74978297-75130970 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75023484 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 15 (I15T)
Ref Sequence ENSEMBL: ENSMUSP00000122773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000155282]
AlphaFold Q99104
Predicted Effect probably damaging
Transcript: ENSMUST00000123128
AA Change: I15T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: I15T

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123531
AA Change: I15T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000136731
AA Change: I15T

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: I15T

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149823
Predicted Effect possibly damaging
Transcript: ENSMUST00000155282
AA Change: I15T

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: I15T

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Meta Mutation Damage Score 0.3409 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 78,749,447 (GRCm39) D1406G possibly damaging Het
Aebp2 T C 6: 140,579,624 (GRCm39) probably null Het
Ap5m1 T A 14: 49,321,339 (GRCm39) Y49* probably null Het
Atp8b5 T C 4: 43,361,953 (GRCm39) probably benign Het
Baz1a A G 12: 54,970,224 (GRCm39) S518P probably damaging Het
Ces1c T A 8: 93,830,821 (GRCm39) D445V probably benign Het
Ctnnbl1 C T 2: 157,713,106 (GRCm39) H464Y probably benign Het
Cyp2j6 T C 4: 96,420,018 (GRCm39) K238E probably benign Het
Gdf10 G A 14: 33,646,148 (GRCm39) R99H probably damaging Het
Gm4779 G A X: 100,836,568 (GRCm39) P116L possibly damaging Het
Gucy2g A G 19: 55,198,708 (GRCm39) S812P probably damaging Het
Ifit3b C T 19: 34,589,417 (GRCm39) Q198* probably null Het
Irgm1 A T 11: 48,757,417 (GRCm39) Y131* probably null Het
Man1c1 G C 4: 134,430,749 (GRCm39) P11R probably damaging Het
Myh7b A G 2: 155,474,175 (GRCm39) N1630S probably benign Het
Naip6 C T 13: 100,437,108 (GRCm39) A472T probably benign Het
Nme6 A G 9: 109,671,159 (GRCm39) probably benign Het
Or11g25 T A 14: 50,723,065 (GRCm39) I50N probably damaging Het
Or5al6 T C 2: 85,976,908 (GRCm39) T57A probably damaging Het
Plch2 T G 4: 155,075,224 (GRCm39) M797L probably benign Het
Plscr2 G T 9: 92,172,724 (GRCm39) E128* probably null Het
Plxna2 T A 1: 194,480,039 (GRCm39) D1403E probably damaging Het
Pou6f2 T C 13: 18,556,552 (GRCm39) T25A unknown Het
Psmb11 T C 14: 54,862,800 (GRCm39) V6A possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptprd T G 4: 76,025,561 (GRCm39) S546R probably benign Het
Rbp3 A G 14: 33,676,411 (GRCm39) N120D probably benign Het
Skint1 C A 4: 111,878,527 (GRCm39) P153H possibly damaging Het
Slc15a4 A G 5: 127,681,600 (GRCm39) probably null Het
Tmem201 A G 4: 149,806,902 (GRCm39) probably benign Het
Ube2v1 T C 2: 167,452,256 (GRCm39) N89D probably damaging Het
Zfp282 A T 6: 47,874,866 (GRCm39) probably null Het
Zfp560 C A 9: 20,260,240 (GRCm39) M207I probably benign Het
Zfp697 T C 3: 98,335,617 (GRCm39) Y461H probably damaging Het
Other mutations in Myo5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75,068,779 (GRCm39) nonsense probably null
IGL00547:Myo5a APN 9 75,048,735 (GRCm39) missense probably benign 0.00
IGL00788:Myo5a APN 9 75,076,241 (GRCm39) missense probably benign 0.15
IGL01327:Myo5a APN 9 75,094,820 (GRCm39) splice site probably benign
IGL01687:Myo5a APN 9 75,063,531 (GRCm39) missense probably benign 0.12
IGL01886:Myo5a APN 9 75,076,372 (GRCm39) splice site probably benign
IGL01945:Myo5a APN 9 75,047,953 (GRCm39) missense probably damaging 1.00
IGL02127:Myo5a APN 9 75,120,263 (GRCm39) missense probably benign 0.12
IGL02137:Myo5a APN 9 75,068,817 (GRCm39) splice site probably null
IGL02183:Myo5a APN 9 75,074,518 (GRCm39) splice site probably benign
IGL02427:Myo5a APN 9 75,083,900 (GRCm39) splice site probably benign
IGL02490:Myo5a APN 9 75,043,737 (GRCm39) missense probably damaging 1.00
IGL02574:Myo5a APN 9 75,118,429 (GRCm39) missense probably benign 0.00
IGL02886:Myo5a APN 9 75,059,169 (GRCm39) splice site probably benign
IGL02961:Myo5a APN 9 75,122,402 (GRCm39) missense probably benign 0.04
IGL03090:Myo5a APN 9 75,028,115 (GRCm39) missense probably damaging 1.00
IGL03119:Myo5a APN 9 75,081,297 (GRCm39) missense probably benign 0.01
IGL03237:Myo5a APN 9 75,037,276 (GRCm39) missense probably damaging 1.00
IGL03296:Myo5a APN 9 75,023,484 (GRCm39) missense probably damaging 1.00
naoki UTSW 9 75,068,774 (GRCm39) missense probably damaging 1.00
new_gray UTSW 9 0 () missense
nut UTSW 9 0 () splice donor site
silver_decerebrate UTSW 9 75,071,477 (GRCm39) missense probably damaging 1.00
silver_decerebrate_2 UTSW 9 75,118,408 (GRCm39) missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75,037,423 (GRCm39) splice site probably benign
IGL03050:Myo5a UTSW 9 75,054,191 (GRCm39) splice site probably null
PIT4403001:Myo5a UTSW 9 75,124,805 (GRCm39) missense probably damaging 1.00
R0047:Myo5a UTSW 9 75,063,489 (GRCm39) missense probably damaging 1.00
R0047:Myo5a UTSW 9 75,063,489 (GRCm39) missense probably damaging 1.00
R0091:Myo5a UTSW 9 75,068,774 (GRCm39) missense probably damaging 1.00
R0142:Myo5a UTSW 9 75,067,856 (GRCm39) missense probably benign 0.01
R0243:Myo5a UTSW 9 75,093,405 (GRCm39) critical splice donor site probably null
R0395:Myo5a UTSW 9 75,101,259 (GRCm39) missense probably benign 0.39
R0427:Myo5a UTSW 9 75,081,478 (GRCm39) missense probably benign 0.00
R0545:Myo5a UTSW 9 75,074,319 (GRCm39) missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75,087,394 (GRCm39) missense probably benign 0.00
R0601:Myo5a UTSW 9 75,081,297 (GRCm39) missense probably benign 0.01
R1457:Myo5a UTSW 9 75,120,347 (GRCm39) missense probably damaging 0.99
R1510:Myo5a UTSW 9 75,078,833 (GRCm39) missense probably benign
R1548:Myo5a UTSW 9 75,079,028 (GRCm39) missense probably damaging 1.00
R1759:Myo5a UTSW 9 75,089,275 (GRCm39) missense possibly damaging 0.72
R1924:Myo5a UTSW 9 75,023,489 (GRCm39) missense probably damaging 1.00
R1960:Myo5a UTSW 9 75,055,139 (GRCm39) missense probably damaging 1.00
R2050:Myo5a UTSW 9 75,054,156 (GRCm39) missense probably benign 0.01
R2070:Myo5a UTSW 9 75,089,266 (GRCm39) missense probably benign 0.03
R2075:Myo5a UTSW 9 75,097,200 (GRCm39) missense probably benign 0.01
R2148:Myo5a UTSW 9 75,087,429 (GRCm39) missense probably damaging 1.00
R2201:Myo5a UTSW 9 75,125,225 (GRCm39) missense possibly damaging 0.51
R2337:Myo5a UTSW 9 75,111,083 (GRCm39) missense probably damaging 1.00
R2357:Myo5a UTSW 9 75,108,647 (GRCm39) missense probably damaging 0.99
R2392:Myo5a UTSW 9 75,116,521 (GRCm39) missense probably benign 0.02
R2432:Myo5a UTSW 9 75,120,155 (GRCm39) missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75,059,179 (GRCm39) missense probably damaging 1.00
R2568:Myo5a UTSW 9 75,030,322 (GRCm39) missense probably damaging 1.00
R2932:Myo5a UTSW 9 75,103,418 (GRCm39) missense possibly damaging 0.85
R4231:Myo5a UTSW 9 75,097,279 (GRCm39) missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75,051,453 (GRCm39) missense probably benign
R4321:Myo5a UTSW 9 75,124,812 (GRCm39) missense probably damaging 0.99
R4450:Myo5a UTSW 9 75,074,458 (GRCm39) missense probably benign 0.00
R4573:Myo5a UTSW 9 75,108,579 (GRCm39) splice site probably null
R4577:Myo5a UTSW 9 75,124,827 (GRCm39) missense probably damaging 1.00
R4601:Myo5a UTSW 9 75,043,670 (GRCm39) missense probably damaging 1.00
R4690:Myo5a UTSW 9 75,061,105 (GRCm39) missense probably damaging 0.99
R4691:Myo5a UTSW 9 75,087,438 (GRCm39) missense probably damaging 0.99
R4764:Myo5a UTSW 9 75,023,618 (GRCm39) intron probably benign
R4767:Myo5a UTSW 9 75,051,358 (GRCm39) missense probably damaging 0.99
R4811:Myo5a UTSW 9 75,048,825 (GRCm39) critical splice donor site probably null
R4829:Myo5a UTSW 9 75,043,689 (GRCm39) missense probably damaging 1.00
R4863:Myo5a UTSW 9 75,124,789 (GRCm39) missense probably damaging 1.00
R4902:Myo5a UTSW 9 75,081,360 (GRCm39) missense probably benign
R4947:Myo5a UTSW 9 75,030,330 (GRCm39) missense probably damaging 1.00
R5074:Myo5a UTSW 9 75,081,438 (GRCm39) missense probably benign
R5095:Myo5a UTSW 9 75,091,671 (GRCm39) nonsense probably null
R5095:Myo5a UTSW 9 75,059,302 (GRCm39) missense probably damaging 1.00
R5254:Myo5a UTSW 9 75,037,402 (GRCm39) missense probably damaging 1.00
R5267:Myo5a UTSW 9 75,059,292 (GRCm39) missense probably damaging 1.00
R5419:Myo5a UTSW 9 75,055,179 (GRCm39) missense probably damaging 1.00
R5514:Myo5a UTSW 9 75,061,048 (GRCm39) missense probably damaging 1.00
R5629:Myo5a UTSW 9 75,111,127 (GRCm39) missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75,079,001 (GRCm39) missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75,074,488 (GRCm39) missense probably benign 0.02
R5665:Myo5a UTSW 9 75,051,463 (GRCm39) critical splice donor site probably null
R5719:Myo5a UTSW 9 75,059,213 (GRCm39) missense probably damaging 1.00
R5964:Myo5a UTSW 9 75,111,115 (GRCm39) missense probably benign 0.09
R6014:Myo5a UTSW 9 75,074,489 (GRCm39) nonsense probably null
R6344:Myo5a UTSW 9 75,067,791 (GRCm39) missense probably benign 0.09
R6345:Myo5a UTSW 9 75,097,195 (GRCm39) missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75,054,249 (GRCm39) missense probably damaging 0.98
R6712:Myo5a UTSW 9 75,120,182 (GRCm39) missense probably benign 0.12
R6838:Myo5a UTSW 9 75,061,165 (GRCm39) critical splice donor site probably null
R6866:Myo5a UTSW 9 75,047,970 (GRCm39) missense probably damaging 1.00
R6876:Myo5a UTSW 9 75,067,772 (GRCm39) missense probably benign 0.04
R7108:Myo5a UTSW 9 75,037,274 (GRCm39) missense probably damaging 1.00
R7159:Myo5a UTSW 9 75,078,845 (GRCm39) missense probably benign 0.07
R7164:Myo5a UTSW 9 75,087,435 (GRCm39) missense probably benign 0.00
R7219:Myo5a UTSW 9 75,028,052 (GRCm39) missense probably damaging 1.00
R7497:Myo5a UTSW 9 75,104,983 (GRCm39) missense
R7620:Myo5a UTSW 9 75,071,418 (GRCm39) missense probably benign 0.41
R7719:Myo5a UTSW 9 75,051,366 (GRCm39) missense probably benign 0.01
R7810:Myo5a UTSW 9 75,076,292 (GRCm39) missense probably benign
R7810:Myo5a UTSW 9 75,067,747 (GRCm39) missense probably benign 0.09
R7866:Myo5a UTSW 9 75,111,034 (GRCm39) missense probably damaging 1.00
R7939:Myo5a UTSW 9 75,097,182 (GRCm39) missense
R8050:Myo5a UTSW 9 75,089,228 (GRCm39) missense probably damaging 0.99
R8061:Myo5a UTSW 9 75,030,239 (GRCm39) nonsense probably null
R8326:Myo5a UTSW 9 75,125,271 (GRCm39) missense probably damaging 0.98
R8529:Myo5a UTSW 9 75,120,154 (GRCm39) missense probably benign 0.02
R8824:Myo5a UTSW 9 75,074,328 (GRCm39) missense probably damaging 1.00
R8858:Myo5a UTSW 9 75,091,965 (GRCm39) missense probably damaging 0.99
R9040:Myo5a UTSW 9 75,081,341 (GRCm39) missense probably benign 0.07
R9092:Myo5a UTSW 9 75,054,414 (GRCm39) critical splice donor site probably null
R9249:Myo5a UTSW 9 75,097,279 (GRCm39) missense possibly damaging 0.67
R9274:Myo5a UTSW 9 75,097,279 (GRCm39) missense possibly damaging 0.67
R9293:Myo5a UTSW 9 75,087,312 (GRCm39) missense probably benign 0.37
R9366:Myo5a UTSW 9 75,124,800 (GRCm39) missense probably damaging 0.98
R9410:Myo5a UTSW 9 75,023,496 (GRCm39) missense probably damaging 0.98
R9644:Myo5a UTSW 9 75,043,631 (GRCm39) missense probably damaging 1.00
R9649:Myo5a UTSW 9 75,099,726 (GRCm39) missense
R9748:Myo5a UTSW 9 75,091,965 (GRCm39) missense probably damaging 0.99
R9766:Myo5a UTSW 9 75,078,914 (GRCm39) missense probably damaging 0.99
X0010:Myo5a UTSW 9 75,093,187 (GRCm39) missense probably damaging 1.00
Z1177:Myo5a UTSW 9 75,093,318 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TGGTACTGGGGCTAACCTAC -3'
(R):5'- GGGGTTAGGCAAGTTATAGCAAAATTC -3'

Sequencing Primer
(F):5'- CCCTGGACTATGCAATAAGATGCTG -3'
(R):5'- AGCAAAATTCTATCTTTCACTCTCC -3'
Posted On 2015-02-05