Incidental Mutation 'R6465:Gcm1'
ID517781
Institutional Source Beutler Lab
Gene Symbol Gcm1
Ensembl Gene ENSMUSG00000023333
Gene Nameglial cells missing homolog 1
Synonymsglide, GCMa, Gcm a, Gcm 1, Gcm1-rs1, glial cell deficient
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6465 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location78051924-78065624 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78064869 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 364 (Y364C)
Ref Sequence ENSEMBL: ENSMUSP00000024104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024104]
PDB Structure
STRUCTURE OF THE GCM DOMAIN BOUND TO DNA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000024104
AA Change: Y364C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024104
Gene: ENSMUSG00000023333
AA Change: Y364C

DomainStartEndE-ValueType
Pfam:GCM 30 167 4.2e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217247
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein with a gcm-motif (glial cell missing motif). The encoded protein is a homolog of the Drosophila glial cells missing gene (gcm). This protein binds to the GCM-motif (A/G)CCCGCAT, a novel sequence among known targets of DNA-binding proteins. The N-terminal DNA-binding domain confers the unique DNA-binding activity of this protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired branching of the chorioallantoic interface, absence of the placental labyrinth, lack of fusion of chorionic trophoblast cells, and lethality between embryonic days 5.5-10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 N25Y possibly damaging Het
A2ml1 G A 6: 128,541,078 T1415I probably damaging Het
Acvr2b T A 9: 119,433,303 W461R probably damaging Het
Adam23 G T 1: 63,566,668 C637F probably damaging Het
Apol8 T G 15: 77,749,948 T143P probably benign Het
Asna1 A T 8: 85,018,565 M291K probably benign Het
Bfsp1 A C 2: 143,858,055 probably null Het
Cytl1 T C 5: 37,737,670 V99A probably benign Het
Dock2 A T 11: 34,503,413 V793E probably damaging Het
Fxyd5 G T 7: 31,037,880 T81K probably damaging Het
Gm37596 A G 3: 93,692,996 I22T probably damaging Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Haghl T C 17: 25,783,819 N190S possibly damaging Het
Inpp5j C A 11: 3,502,293 R319L possibly damaging Het
Ints10 A G 8: 68,807,536 N304S probably benign Het
Isoc1 T A 18: 58,671,256 C119S probably damaging Het
Klhl18 A G 9: 110,428,920 M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 probably benign Het
Krtap3-1 G A 11: 99,566,451 P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A G 7: 98,062,680 V1754A possibly damaging Het
Nedd4l T A 18: 65,155,264 D119E probably benign Het
Nsun7 T C 5: 66,295,586 V548A probably benign Het
Olfr1024 A T 2: 85,904,539 S172T probably benign Het
Olfr711 A T 7: 106,972,212 V44E possibly damaging Het
Parvg A G 15: 84,328,940 D127G probably damaging Het
Piezo2 T A 18: 63,041,663 M2007L possibly damaging Het
Pou2f3 A C 9: 43,139,867 F175V probably damaging Het
Ptprn2 T C 12: 117,269,589 I958T probably damaging Het
Pwwp2b T C 7: 139,256,035 V464A probably benign Het
Pzp A G 6: 128,491,619 Y982H probably damaging Het
Rad17 T A 13: 100,637,080 N202I probably benign Het
Rtel1 T A 2: 181,335,940 D271E possibly damaging Het
Sos2 T C 12: 69,596,775 S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 H241R probably benign Het
Ttc8 A G 12: 98,964,570 E291G probably damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Ylpm1 T A 12: 85,049,802 D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 Y586C possibly damaging Het
Zcchc4 T A 5: 52,819,276 F471I probably benign Het
Zfp719 C A 7: 43,590,684 Y565* probably null Het
Other mutations in Gcm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Gcm1 APN 9 78065016 missense probably benign 0.09
IGL02132:Gcm1 APN 9 78064839 missense possibly damaging 0.95
IGL02820:Gcm1 APN 9 78064562 missense probably benign
IGL03074:Gcm1 APN 9 78064775 missense possibly damaging 0.84
PIT4280001:Gcm1 UTSW 9 78059633 missense probably damaging 1.00
R0720:Gcm1 UTSW 9 78064641 missense possibly damaging 0.68
R1271:Gcm1 UTSW 9 78059577 missense probably benign 0.05
R1421:Gcm1 UTSW 9 78059700 missense probably damaging 1.00
R1481:Gcm1 UTSW 9 78059717 nonsense probably null
R1884:Gcm1 UTSW 9 78059579 missense probably benign 0.01
R1907:Gcm1 UTSW 9 78064773 missense probably benign 0.00
R2029:Gcm1 UTSW 9 78065044 missense possibly damaging 0.70
R2160:Gcm1 UTSW 9 78061380 missense probably benign 0.05
R3103:Gcm1 UTSW 9 78064452 missense probably damaging 0.98
R3944:Gcm1 UTSW 9 78059816 nonsense probably null
R5292:Gcm1 UTSW 9 78061426 missense probably damaging 1.00
R5769:Gcm1 UTSW 9 78064967 missense probably benign
R6446:Gcm1 UTSW 9 78059783 missense probably benign 0.08
R7114:Gcm1 UTSW 9 78059779 missense probably damaging 1.00
R7212:Gcm1 UTSW 9 78059643 missense possibly damaging 0.84
R7398:Gcm1 UTSW 9 78064679 missense probably benign 0.00
R7584:Gcm1 UTSW 9 78064467 missense possibly damaging 0.62
R8130:Gcm1 UTSW 9 78064534 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACGAAGACCTGCAAACTTGG -3'
(R):5'- AAGTGATCTAAGCCCATGCATG -3'

Sequencing Primer
(F):5'- ATGTTGCCTTAGGGAGAAATCC -3'
(R):5'- GATCTAAGCCCATGCATGCCATC -3'
Posted On2018-05-21