Incidental Mutation 'R4904:Ptch1'
ID378059
Institutional Source Beutler Lab
Gene Symbol Ptch1
Ensembl Gene ENSMUSG00000021466
Gene Namepatched 1
SynonymsA230106A15Rik, Patched 1, Ptc1, Ptc
MMRRC Submission 042507-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4904 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location63508328-63573598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 63523004 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 904 (I904S)
Ref Sequence ENSEMBL: ENSMUSP00000141489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000194663] [ENSMUST00000195258]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021921
AA Change: I1041S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: I1041S

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
Pfam:Patched 351 871 7.6e-47 PFAM
Pfam:Sterol-sensing 448 602 1.5e-45 PFAM
Pfam:Patched 952 1166 9.8e-33 PFAM
low complexity region 1180 1189 N/A INTRINSIC
low complexity region 1204 1213 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1369 1384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192155
AA Change: I904S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: I904S

DomainStartEndE-ValueType
Pfam:Patched 214 733 3.1e-44 PFAM
Pfam:Sterol-sensing 311 465 2.8e-46 PFAM
Pfam:Patched 814 1029 3.1e-30 PFAM
low complexity region 1043 1052 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1144 1159 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1232 1247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194663
SMART Domains Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
Pfam:Patched 298 569 4.7e-34 PFAM
Pfam:Sterol-sensing 396 550 7.9e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195258
SMART Domains Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
Pfam:Patched 212 426 7.8e-28 PFAM
Pfam:Sterol-sensing 311 426 8e-33 PFAM
Meta Mutation Damage Score 0.5329 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 94% (82/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 T G 4: 130,012,539 I920S possibly damaging Het
Afap1l1 A G 18: 61,738,715 I556T probably benign Het
Ankfy1 C A 11: 72,752,105 H665N probably benign Het
Aqp9 A C 9: 71,162,403 probably benign Het
Arhgap21 A G 2: 20,850,061 S1497P probably benign Het
Armc7 A G 11: 115,488,974 D166G probably damaging Het
Arrdc1 C A 2: 24,926,664 V167F possibly damaging Het
AW822073 T A 10: 58,223,487 R482* probably null Het
Col6a3 A T 1: 90,801,442 I1259N probably damaging Het
Coq8a C T 1: 180,178,603 R207Q probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcbld1 C T 10: 52,319,970 Q425* probably null Het
Def8 A G 8: 123,461,480 N445D probably damaging Het
Dicer1 C T 12: 104,713,066 V551I probably benign Het
Dst A T 1: 34,169,798 T800S probably damaging Het
Dtl A T 1: 191,568,345 C136S probably damaging Het
Duox1 T A 2: 122,320,864 Y310N probably damaging Het
Ebf1 T C 11: 44,869,169 F211S probably damaging Het
Gm44501 A T 17: 40,578,993 I133F possibly damaging Het
Gm6625 T C 8: 89,146,751 noncoding transcript Het
Golgb1 A T 16: 36,893,386 D243V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l G A 17: 88,690,043 probably null Het
Herc2 T C 7: 56,157,486 F2471L probably damaging Het
Hfe A T 13: 23,708,054 I109N probably damaging Het
Hrg A G 16: 22,951,250 E43G probably benign Het
Hspa1a T C 17: 34,970,451 D492G probably damaging Het
Itgb8 T C 12: 119,170,871 D487G probably benign Het
Jag1 A G 2: 137,087,142 V798A probably damaging Het
Kcnq5 A G 1: 21,424,100 V501A probably damaging Het
Kntc1 T C 5: 123,778,333 V743A possibly damaging Het
Ly86 G T 13: 37,415,520 V126F possibly damaging Het
Med26 A T 8: 72,496,847 L136H probably damaging Het
Mpp3 T C 11: 102,000,587 D575G probably benign Het
Myoc G A 1: 162,639,425 M54I probably benign Het
Nlrp1c-ps A G 11: 71,242,628 noncoding transcript Het
Olfr111 A G 17: 37,530,631 Y218C probably damaging Het
Olfr1418 C T 19: 11,855,867 V29M possibly damaging Het
Olfr574 A G 7: 102,949,065 Y190C probably damaging Het
Pak7 A T 2: 136,083,347 D678E probably benign Het
Pcdhb12 T C 18: 37,437,856 V685A possibly damaging Het
Pcdhga2 A G 18: 37,669,879 T259A possibly damaging Het
Pde6a A T 18: 61,265,034 M702L probably benign Het
Pigq A G 17: 25,931,060 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Rflnb A T 11: 76,022,138 C141* probably null Het
Rilpl1 C A 5: 124,514,744 probably null Het
Rpgrip1 T C 14: 52,121,087 S217P possibly damaging Het
Rpgrip1 A T 14: 52,160,129 I1292F probably damaging Het
Sema3a A C 5: 13,581,098 Y534S probably damaging Het
Sez6 A G 11: 77,975,254 Y736C probably damaging Het
Shank1 G T 7: 44,334,040 probably benign Het
Slc45a4 G A 15: 73,586,842 S294F probably benign Het
Slc9a8 A G 2: 167,471,396 I393V possibly damaging Het
Sod1 T A 16: 90,222,844 F46Y probably damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Syn3 T G 10: 86,467,086 K68N possibly damaging Het
Taar8c C T 10: 24,101,249 V222I probably benign Het
Tbx20 T C 9: 24,758,833 K235E probably damaging Het
Tcaf3 C A 6: 42,593,997 E274* probably null Het
Tll1 A T 8: 64,070,199 M493K probably benign Het
Tmem236 T A 2: 14,195,992 S123T probably benign Het
Trim33 T C 3: 103,331,647 V647A possibly damaging Het
Tspear T A 10: 77,869,655 Y296N possibly damaging Het
Vps13d T C 4: 145,155,445 K1187E probably damaging Het
Xpot C T 10: 121,617,178 V52I probably benign Het
Zdhhc3 A T 9: 123,100,387 V61E probably damaging Het
Zfp955a A T 17: 33,242,188 C323* probably null Het
Other mutations in Ptch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Ptch1 APN 13 63527175 missense probably benign 0.00
IGL01084:Ptch1 APN 13 63543637 missense probably damaging 0.99
IGL01369:Ptch1 APN 13 63511681 missense probably benign
IGL02260:Ptch1 APN 13 63565352 unclassified probably benign
IGL02439:Ptch1 APN 13 63545096 missense probably damaging 1.00
IGL02588:Ptch1 APN 13 63511918 missense probably benign 0.13
IGL02797:Ptch1 APN 13 63533607 missense probably benign
R0463:Ptch1 UTSW 13 63520307 missense probably damaging 0.98
R0539:Ptch1 UTSW 13 63543480 splice site probably benign
R0657:Ptch1 UTSW 13 63513751 missense possibly damaging 0.90
R0971:Ptch1 UTSW 13 63539843 missense probably benign 0.23
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1539:Ptch1 UTSW 13 63541287 missense probably benign 0.00
R1616:Ptch1 UTSW 13 63539842 missense possibly damaging 0.96
R1883:Ptch1 UTSW 13 63512027 nonsense probably null
R1985:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R1986:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2024:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2025:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2026:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2027:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2096:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2097:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2100:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2105:Ptch1 UTSW 13 63545245 missense probably benign
R2165:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2166:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2167:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2168:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2226:Ptch1 UTSW 13 63513671 missense probably damaging 1.00
R2437:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2504:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2507:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2696:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63542224 missense probably damaging 1.00
R2971:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3410:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3708:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3744:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3745:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3783:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3784:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3785:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3807:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3950:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4013:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4015:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4016:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4017:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4035:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4083:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4084:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4179:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4222:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4348:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4349:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4350:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4351:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4353:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4485:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4595:Ptch1 UTSW 13 63543608 missense possibly damaging 0.68
R4625:Ptch1 UTSW 13 63523164 missense probably benign 0.02
R4809:Ptch1 UTSW 13 63513708 missense probably damaging 0.98
R4911:Ptch1 UTSW 13 63523052 missense probably damaging 1.00
R4942:Ptch1 UTSW 13 63525070 missense probably benign 0.02
R5386:Ptch1 UTSW 13 63545043 missense probably damaging 0.98
R5447:Ptch1 UTSW 13 63527245 missense probably benign
R5604:Ptch1 UTSW 13 63525122 missense probably benign 0.01
R5846:Ptch1 UTSW 13 63565454 unclassified probably benign
R5926:Ptch1 UTSW 13 63545055 missense probably benign 0.01
R5945:Ptch1 UTSW 13 63573419 utr 5 prime probably benign
R5957:Ptch1 UTSW 13 63525115 missense probably damaging 1.00
R6326:Ptch1 UTSW 13 63543545 missense probably damaging 1.00
R6358:Ptch1 UTSW 13 63513689 missense probably damaging 0.96
R6376:Ptch1 UTSW 13 63543608 missense possibly damaging 0.68
R6599:Ptch1 UTSW 13 63523104 missense probably damaging 0.98
R6615:Ptch1 UTSW 13 63539830 missense possibly damaging 0.46
R6965:Ptch1 UTSW 13 63525067 missense possibly damaging 0.63
R7149:Ptch1 UTSW 13 63511736 missense probably benign 0.23
R7168:Ptch1 UTSW 13 63512060 missense probably benign
R7257:Ptch1 UTSW 13 63573294 missense not run
R7258:Ptch1 UTSW 13 63573294 missense not run
R7259:Ptch1 UTSW 13 63573294 missense not run
R7368:Ptch1 UTSW 13 63511984 missense probably benign 0.06
R7525:Ptch1 UTSW 13 63511714 missense probably benign 0.00
R7528:Ptch1 UTSW 13 63511714 missense probably benign 0.00
R7820:Ptch1 UTSW 13 63523061 missense probably damaging 1.00
R8077:Ptch1 UTSW 13 63540812 missense probably damaging 0.98
Z1177:Ptch1 UTSW 13 63520279 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGGCGTTAGAAGGATCCC -3'
(R):5'- ACACCTCAGACTTTGTGGAAG -3'

Sequencing Primer
(F):5'- GCGTTAGAAGGATCCCCATGAAC -3'
(R):5'- CCTCAGACTTTGTGGAAGCCATAG -3'
Posted On2016-04-15