Incidental Mutation 'R4625:Ptch1'
ID346512
Institutional Source Beutler Lab
Gene Symbol Ptch1
Ensembl Gene ENSMUSG00000021466
Gene Namepatched 1
SynonymsA230106A15Rik, Patched 1, Ptc1, Ptc
MMRRC Submission 041890-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4625 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location63508328-63573598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63523164 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 851 (T851A)
Ref Sequence ENSEMBL: ENSMUSP00000141489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000194663] [ENSMUST00000195258]
Predicted Effect probably benign
Transcript: ENSMUST00000021921
AA Change: T988A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: T988A

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
Pfam:Patched 351 871 7.6e-47 PFAM
Pfam:Sterol-sensing 448 602 1.5e-45 PFAM
Pfam:Patched 952 1166 9.8e-33 PFAM
low complexity region 1180 1189 N/A INTRINSIC
low complexity region 1204 1213 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1369 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192155
AA Change: T851A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: T851A

DomainStartEndE-ValueType
Pfam:Patched 214 733 3.1e-44 PFAM
Pfam:Sterol-sensing 311 465 2.8e-46 PFAM
Pfam:Patched 814 1029 3.1e-30 PFAM
low complexity region 1043 1052 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1144 1159 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1232 1247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194663
SMART Domains Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
Pfam:Patched 298 569 4.7e-34 PFAM
Pfam:Sterol-sensing 396 550 7.9e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195258
SMART Domains Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
Pfam:Patched 212 426 7.8e-28 PFAM
Pfam:Sterol-sensing 311 426 8e-33 PFAM
Meta Mutation Damage Score 0.0929 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A C 5: 145,044,883 E176A possibly damaging Het
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
4933417A18Rik G A 13: 34,932,465 G66S probably damaging Het
5830473C10Rik G T 5: 90,571,752 V236L probably damaging Het
Abcc2 A G 19: 43,803,739 I320V probably benign Het
Abtb1 C T 6: 88,836,287 A466T probably benign Het
Ak6 C A 13: 100,655,673 T208K probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Anapc15 T A 7: 101,901,032 probably benign Het
Aspn A G 13: 49,557,425 D182G probably benign Het
Astn1 A T 1: 158,580,294 D607V probably damaging Het
Btnl1 A G 17: 34,379,751 I114V probably null Het
Ccdc159 A G 9: 21,929,466 S110G probably benign Het
Ccdc94 T A 17: 55,964,598 L173Q probably damaging Het
Cdh18 A C 15: 22,714,042 probably benign Het
Cdh22 A G 2: 165,112,606 I665T probably damaging Het
Cenpk T A 13: 104,249,393 H265Q possibly damaging Het
Chd6 A G 2: 160,969,492 L1397P probably damaging Het
Chia1 A C 3: 106,128,940 N279H probably benign Het
Cyp8b1 T C 9: 121,915,585 E227G probably damaging Het
Dmxl2 A T 9: 54,404,120 N1772K possibly damaging Het
Dnah2 A G 11: 69,463,661 S2244P probably damaging Het
Fshr T C 17: 88,985,720 Y510C probably damaging Het
Gm21188 G T 13: 120,035,229 R35S possibly damaging Het
Gm5087 T C 14: 13,158,798 noncoding transcript Het
Gm7135 A C 1: 97,459,626 noncoding transcript Het
Hnrnpll A T 17: 80,050,862 Y153* probably null Het
Htt T A 5: 34,829,785 V1116E probably damaging Het
Ikzf5 A T 7: 131,393,753 probably null Het
Kcnb1 A G 2: 167,188,233 S131P probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Kif1a A T 1: 93,042,659 D952E probably benign Het
Klf4 A G 4: 55,530,370 V247A probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lamc1 A G 1: 153,242,696 S910P probably benign Het
Lin9 T A 1: 180,689,280 N512K probably damaging Het
Mettl7a1 A T 15: 100,313,058 Q170L probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Mrps30 A G 13: 118,386,714 V174A probably benign Het
Myo1g T C 11: 6,512,240 E574G probably damaging Het
Nphp3 G A 9: 104,036,159 G997R possibly damaging Het
Obscn A G 11: 59,067,258 C3748R probably damaging Het
Olfr346 A G 2: 36,688,071 D23G probably benign Het
Olfr466 T A 13: 65,152,860 V212D possibly damaging Het
Olfr494 T C 7: 108,367,688 L66P probably damaging Het
Olfr945 A T 9: 39,258,318 M118K probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rbp3 A G 14: 33,956,099 Q668R probably benign Het
Rfwd3 T C 8: 111,276,358 T611A probably benign Het
Rhcg T A 7: 79,601,604 D219V probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Slc25a26 G T 6: 94,507,652 V58F probably damaging Het
Smarca5 T A 8: 80,710,563 K721N probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Speer2 A T 16: 69,858,754 Y61* probably null Het
Spef2 T C 15: 9,647,438 Y961C probably damaging Het
Sptb C A 12: 76,587,326 probably null Het
Svep1 T G 4: 58,072,698 N2204H probably damaging Het
Tmem86a C A 7: 47,052,865 P13T probably damaging Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Tox2 G A 2: 163,314,416 S211N possibly damaging Het
Trpc6 A T 9: 8,677,962 E762D probably benign Het
Tshb C T 3: 102,778,145 probably null Het
Ttc3 T A 16: 94,388,272 L163* probably null Het
Twsg1 G T 17: 65,929,551 D161E probably benign Het
Uchl4 A C 9: 64,235,798 D187A probably damaging Het
Vmn2r104 A T 17: 20,048,181 W9R probably benign Het
Zfp14 G A 7: 30,038,595 Q322* probably null Het
Znhit3 G A 11: 84,911,490 P145S probably damaging Het
Other mutations in Ptch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Ptch1 APN 13 63527175 missense probably benign 0.00
IGL01084:Ptch1 APN 13 63543637 missense probably damaging 0.99
IGL01369:Ptch1 APN 13 63511681 missense probably benign
IGL02260:Ptch1 APN 13 63565352 unclassified probably benign
IGL02439:Ptch1 APN 13 63545096 missense probably damaging 1.00
IGL02588:Ptch1 APN 13 63511918 missense probably benign 0.13
IGL02797:Ptch1 APN 13 63533607 missense probably benign
R0463:Ptch1 UTSW 13 63520307 missense probably damaging 0.98
R0539:Ptch1 UTSW 13 63543480 splice site probably benign
R0657:Ptch1 UTSW 13 63513751 missense possibly damaging 0.90
R0971:Ptch1 UTSW 13 63539843 missense probably benign 0.23
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1539:Ptch1 UTSW 13 63541287 missense probably benign 0.00
R1616:Ptch1 UTSW 13 63539842 missense possibly damaging 0.96
R1883:Ptch1 UTSW 13 63512027 nonsense probably null
R1985:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R1986:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2024:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2025:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2026:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2027:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2096:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2097:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2100:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2105:Ptch1 UTSW 13 63545245 missense probably benign
R2165:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2166:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2167:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2168:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2226:Ptch1 UTSW 13 63513671 missense probably damaging 1.00
R2437:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2504:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2507:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2696:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63542224 missense probably damaging 1.00
R2971:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3410:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3708:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3744:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3745:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3783:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3784:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3785:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3807:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3950:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4013:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4015:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4016:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4017:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4035:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4083:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4084:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4179:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4222:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4348:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4349:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4350:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4351:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4353:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4485:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4595:Ptch1 UTSW 13 63543608 missense possibly damaging 0.68
R4809:Ptch1 UTSW 13 63513708 missense probably damaging 0.98
R4904:Ptch1 UTSW 13 63523004 missense probably damaging 1.00
R4911:Ptch1 UTSW 13 63523052 missense probably damaging 1.00
R4942:Ptch1 UTSW 13 63525070 missense probably benign 0.02
R5386:Ptch1 UTSW 13 63545043 missense probably damaging 0.98
R5447:Ptch1 UTSW 13 63527245 missense probably benign
R5604:Ptch1 UTSW 13 63525122 missense probably benign 0.01
R5846:Ptch1 UTSW 13 63565454 unclassified probably benign
R5926:Ptch1 UTSW 13 63545055 missense probably benign 0.01
R5945:Ptch1 UTSW 13 63573419 utr 5 prime probably benign
R5957:Ptch1 UTSW 13 63525115 missense probably damaging 1.00
R6326:Ptch1 UTSW 13 63543545 missense probably damaging 1.00
R6358:Ptch1 UTSW 13 63513689 missense probably damaging 0.96
R6376:Ptch1 UTSW 13 63543608 missense possibly damaging 0.68
R6599:Ptch1 UTSW 13 63523104 missense probably damaging 0.98
R6615:Ptch1 UTSW 13 63539830 missense possibly damaging 0.46
R6965:Ptch1 UTSW 13 63525067 missense possibly damaging 0.63
R7149:Ptch1 UTSW 13 63511736 missense probably benign 0.23
R7168:Ptch1 UTSW 13 63512060 missense probably benign
R7257:Ptch1 UTSW 13 63573294 missense not run
R7258:Ptch1 UTSW 13 63573294 missense not run
R7259:Ptch1 UTSW 13 63573294 missense not run
R7368:Ptch1 UTSW 13 63511984 missense probably benign 0.06
R7525:Ptch1 UTSW 13 63511714 missense probably benign 0.00
R7528:Ptch1 UTSW 13 63511714 missense probably benign 0.00
R7820:Ptch1 UTSW 13 63523061 missense probably damaging 1.00
Z1177:Ptch1 UTSW 13 63520279 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAAAACTTCCCGGCTGCAG -3'
(R):5'- TACCTCACACCCAGTGTCTG -3'

Sequencing Primer
(F):5'- CTGTGTTGAAAGGAATCTGACTTCC -3'
(R):5'- CAGTGTCTGTCTTCACCGGG -3'
Posted On2015-09-25