Incidental Mutation 'R6376:Ptch1'
ID514996
Institutional Source Beutler Lab
Gene Symbol Ptch1
Ensembl Gene ENSMUSG00000021466
Gene Namepatched 1
SynonymsA230106A15Rik, Patched 1, Ptc1, Ptc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6376 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location63508328-63573598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63543608 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 277 (D277G)
Ref Sequence ENSEMBL: ENSMUSP00000141298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000193953] [ENSMUST00000194663] [ENSMUST00000195106] [ENSMUST00000195258] [ENSMUST00000195756]
Predicted Effect probably benign
Transcript: ENSMUST00000021921
AA Change: D262G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: D262G

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
Pfam:Patched 351 871 7.6e-47 PFAM
Pfam:Sterol-sensing 448 602 1.5e-45 PFAM
Pfam:Patched 952 1166 9.8e-33 PFAM
low complexity region 1180 1189 N/A INTRINSIC
low complexity region 1204 1213 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1369 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192155
AA Change: D125G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: D125G

DomainStartEndE-ValueType
Pfam:Patched 214 733 3.1e-44 PFAM
Pfam:Sterol-sensing 311 465 2.8e-46 PFAM
Pfam:Patched 814 1029 3.1e-30 PFAM
low complexity region 1043 1052 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1144 1159 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1232 1247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193953
AA Change: D125G

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000194663
AA Change: D210G

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466
AA Change: D210G

DomainStartEndE-ValueType
Pfam:Patched 298 569 4.7e-34 PFAM
Pfam:Sterol-sensing 396 550 7.9e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000195106
AA Change: D277G

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141298
Gene: ENSMUSG00000021466
AA Change: D277G

DomainStartEndE-ValueType
low complexity region 38 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195258
AA Change: D155G

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466
AA Change: D155G

DomainStartEndE-ValueType
Pfam:Patched 212 426 7.8e-28 PFAM
Pfam:Sterol-sensing 311 426 8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195756
AA Change: D125G

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223515
Meta Mutation Damage Score 0.0979 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,428,156 E106D probably damaging Het
4933425L06Rik T C 13: 105,119,965 I514T possibly damaging Het
A830018L16Rik A T 1: 11,798,494 N333Y probably damaging Het
Abca4 T A 3: 122,123,660 M1007K possibly damaging Het
Accsl T A 2: 93,856,998 I495F probably damaging Het
Acsl3 T C 1: 78,696,465 S373P possibly damaging Het
Adam7 A G 14: 68,505,097 I689T possibly damaging Het
Akap11 G A 14: 78,514,896 T179I probably damaging Het
Ankmy1 T C 1: 92,888,465 K309R possibly damaging Het
Apaf1 A T 10: 91,023,811 I824N probably damaging Het
Apc2 T A 10: 80,312,654 C1152S probably damaging Het
Arhgap17 C A 7: 123,300,504 W409L probably damaging Het
Arhgef15 T C 11: 68,954,970 I19V unknown Het
Arnt C A 3: 95,490,625 P573H probably damaging Het
Arvcf G A 16: 18,405,132 G932R probably damaging Het
Atg4a-ps C T 3: 103,645,728 W99* probably null Het
Atp13a5 T A 16: 29,237,252 D1052V probably benign Het
Atp2b4 T C 1: 133,715,059 T1103A probably damaging Het
B4galnt4 C A 7: 141,067,422 Q362K possibly damaging Het
Cd163l1 G A 7: 140,228,729 G851D probably damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cep170b A T 12: 112,732,068 I87F probably damaging Het
Coq3 T G 4: 21,900,486 C238G probably benign Het
Cpa5 A T 6: 30,614,045 Q62L probably benign Het
Ctsg A T 14: 56,101,653 C49* probably null Het
Cul9 T C 17: 46,508,563 T2000A probably damaging Het
Dedd C T 1: 171,340,222 P155S probably benign Het
Dnah1 A G 14: 31,275,608 S2598P probably damaging Het
Dnah14 C T 1: 181,605,894 P379S possibly damaging Het
Dync2h1 A T 9: 7,165,703 S519R probably benign Het
Eea1 A G 10: 96,038,798 S1192G probably benign Het
Eif5b T C 1: 38,045,679 I869T probably damaging Het
Elavl4 C A 4: 110,255,454 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ets2 G A 16: 95,718,993 R421H probably damaging Het
Exoc3l2 G A 7: 19,469,710 A76T possibly damaging Het
Fam89b T C 19: 5,728,729 Y144C probably damaging Het
Greb1 T C 12: 16,699,579 E1082G probably damaging Het
Gtf3a A T 5: 146,953,988 probably null Het
Hoxc12 C A 15: 102,937,089 F79L possibly damaging Het
Hspb8 G T 5: 116,409,432 L164I probably damaging Het
Ina C T 19: 47,015,125 A124V probably benign Het
Inhbb T A 1: 119,417,681 I293F probably damaging Het
Itpr3 A G 17: 27,095,475 Y633C possibly damaging Het
Jag2 C T 12: 112,909,329 V1102I probably benign Het
Kalrn A T 16: 33,975,991 F1138Y probably benign Het
Large2 T A 2: 92,370,508 probably benign Het
Lats2 A G 14: 57,722,509 S177P probably benign Het
Lims2 G A 18: 31,954,462 R124H possibly damaging Het
Lrp2 T A 2: 69,483,443 T2315S probably benign Het
Lrrc4c A C 2: 97,629,046 T6P probably benign Het
Lrrk2 T C 15: 91,742,266 L1171S possibly damaging Het
Man2b2 A T 5: 36,821,034 M302K probably damaging Het
Mocos G A 18: 24,701,485 G860R possibly damaging Het
Mylk3 T A 8: 85,358,942 D258V possibly damaging Het
Nkx1-2 C T 7: 132,599,511 D6N probably damaging Het
Nrp2 A G 1: 62,719,017 N54S possibly damaging Het
Olfr715 A G 7: 107,128,641 F251L probably benign Het
Pacsin1 A T 17: 27,707,905 T195S probably benign Het
Pank4 T C 4: 154,972,236 probably null Het
Pdgfra A T 5: 75,166,519 M126L probably benign Het
Podxl T A 6: 31,528,497 T204S probably benign Het
Pole G A 5: 110,336,374 D2175N probably damaging Het
Pramef25 C T 4: 143,950,697 G104E probably benign Het
Prkdc A G 16: 15,769,885 K2545E probably benign Het
Prodh T C 16: 18,079,985 I183V probably benign Het
Rapgef5 G A 12: 117,721,253 V246M probably damaging Het
Rubcnl A G 14: 75,032,394 N164S probably benign Het
Samd4 A T 14: 47,052,962 L175F probably damaging Het
Scimp C A 11: 70,798,067 W41L possibly damaging Het
Scn3a T A 2: 65,461,499 K1634N possibly damaging Het
Spta1 A G 1: 174,203,322 R957G probably benign Het
Sptlc3 T A 2: 139,636,772 N550K probably benign Het
Srebf1 T C 11: 60,203,535 N609D probably null Het
Styxl1 A T 5: 135,747,810 L164H probably benign Het
Synpo2l A T 14: 20,660,634 D865E probably damaging Het
Tnfsf15 T C 4: 63,745,030 M19V probably damaging Het
Trappc8 G C 18: 20,837,075 R953G probably benign Het
Trav13-1 A G 14: 53,545,343 N50S probably benign Het
Trim12a T C 7: 104,306,034 K161E probably benign Het
Vipr1 C A 9: 121,664,574 N230K probably damaging Het
Xirp1 A T 9: 120,018,491 V3E probably damaging Het
Zfp768 A G 7: 127,344,720 F82L probably benign Het
Other mutations in Ptch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Ptch1 APN 13 63527175 missense probably benign 0.00
IGL01084:Ptch1 APN 13 63543637 missense probably damaging 0.99
IGL01369:Ptch1 APN 13 63511681 missense probably benign
IGL02260:Ptch1 APN 13 63565352 unclassified probably benign
IGL02439:Ptch1 APN 13 63545096 missense probably damaging 1.00
IGL02588:Ptch1 APN 13 63511918 missense probably benign 0.13
IGL02797:Ptch1 APN 13 63533607 missense probably benign
R0463:Ptch1 UTSW 13 63520307 missense probably damaging 0.98
R0539:Ptch1 UTSW 13 63543480 splice site probably benign
R0657:Ptch1 UTSW 13 63513751 missense possibly damaging 0.90
R0971:Ptch1 UTSW 13 63539843 missense probably benign 0.23
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1539:Ptch1 UTSW 13 63541287 missense probably benign 0.00
R1616:Ptch1 UTSW 13 63539842 missense possibly damaging 0.96
R1883:Ptch1 UTSW 13 63512027 nonsense probably null
R1985:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R1986:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2024:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2025:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2026:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2027:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2096:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2097:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2100:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2105:Ptch1 UTSW 13 63545245 missense probably benign
R2165:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2166:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2167:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2168:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2226:Ptch1 UTSW 13 63513671 missense probably damaging 1.00
R2437:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2504:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2507:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2696:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63542224 missense probably damaging 1.00
R2971:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3410:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3708:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3744:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3745:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3783:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3784:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3785:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3807:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3950:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4013:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4015:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4016:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4017:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4035:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4083:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4084:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4179:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4222:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4348:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4349:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4350:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4351:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4353:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4485:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4595:Ptch1 UTSW 13 63543608 missense possibly damaging 0.68
R4625:Ptch1 UTSW 13 63523164 missense probably benign 0.02
R4809:Ptch1 UTSW 13 63513708 missense probably damaging 0.98
R4904:Ptch1 UTSW 13 63523004 missense probably damaging 1.00
R4911:Ptch1 UTSW 13 63523052 missense probably damaging 1.00
R4942:Ptch1 UTSW 13 63525070 missense probably benign 0.02
R5386:Ptch1 UTSW 13 63545043 missense probably damaging 0.98
R5447:Ptch1 UTSW 13 63527245 missense probably benign
R5604:Ptch1 UTSW 13 63525122 missense probably benign 0.01
R5846:Ptch1 UTSW 13 63565454 unclassified probably benign
R5926:Ptch1 UTSW 13 63545055 missense probably benign 0.01
R5945:Ptch1 UTSW 13 63573419 utr 5 prime probably benign
R5957:Ptch1 UTSW 13 63525115 missense probably damaging 1.00
R6326:Ptch1 UTSW 13 63543545 missense probably damaging 1.00
R6358:Ptch1 UTSW 13 63513689 missense probably damaging 0.96
R6599:Ptch1 UTSW 13 63523104 missense probably damaging 0.98
R6615:Ptch1 UTSW 13 63539830 missense possibly damaging 0.46
R6965:Ptch1 UTSW 13 63525067 missense possibly damaging 0.63
R7149:Ptch1 UTSW 13 63511736 missense probably benign 0.23
R7168:Ptch1 UTSW 13 63512060 missense probably benign
R7257:Ptch1 UTSW 13 63573294 missense not run
R7258:Ptch1 UTSW 13 63573294 missense not run
R7259:Ptch1 UTSW 13 63573294 missense not run
R7368:Ptch1 UTSW 13 63511984 missense probably benign 0.06
R7525:Ptch1 UTSW 13 63511714 missense probably benign 0.00
R7528:Ptch1 UTSW 13 63511714 missense probably benign 0.00
R7820:Ptch1 UTSW 13 63523061 missense probably damaging 1.00
R8077:Ptch1 UTSW 13 63540812 missense probably damaging 0.98
R8373:Ptch1 UTSW 13 63541168 missense probably damaging 1.00
R8398:Ptch1 UTSW 13 63525125 missense probably benign 0.06
R8407:Ptch1 UTSW 13 63514243 missense probably null 1.00
Z1177:Ptch1 UTSW 13 63520279 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGCCAAACGAAATCTTCAGG -3'
(R):5'- TCCTTTATACTCAGGCCCCAGAG -3'

Sequencing Primer
(F):5'- CAAACGAAATCTTCAGGATGAAAATC -3'
(R):5'- ATACTCAGGCCCCAGAGTTTTG -3'
Posted On2018-05-04