Incidental Mutation 'R1763:Galc'
ID 193217
Institutional Source Beutler Lab
Gene Symbol Galc
Ensembl Gene ENSMUSG00000021003
Gene Name galactosylceramidase
Synonyms Gacy, A930008M05Rik, 2310068B06Rik, galactocerebrosidase
MMRRC Submission 039795-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1763 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 98202294-98259459 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98234266 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 295 (N295S)
Ref Sequence ENSEMBL: ENSMUSP00000021390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021390]
AlphaFold P54818
PDB Structure STRUCTURE OF GALACTOCEREBROSIDASE FROM MOUSE [X-RAY DIFFRACTION]
STRUCTURE OF GALACTOCEREBROSIDASE FROM MOUSE IN COMPLEX WITH GALACTOSE [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE GALACTOCEREBROSIDASE WITH 4NBDG: ENZYME-SUBSTRATE COMPLEX [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE GALACTOCEREBROSIDASE WITH D-GALACTAL: ENZYME- INTERMEDIATE COMPLEX [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE GALACTOCEREBROSIDASE WITH GALACTOSE: ENZYME- PRODUCT COMPLEX [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000021390
AA Change: N295S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021390
Gene: ENSMUSG00000021003
AA Change: N295S

DomainStartEndE-ValueType
Pfam:Glyco_hydro_59 17 684 N/A PFAM
Predicted Effect unknown
Transcript: ENSMUST00000221063
AA Change: N101S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222379
Meta Mutation Damage Score 0.9533 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: This gene encodes galactosylceramidase, the lysosomal hydryolase involved in the catabolism of galactosylceramide. Mutations in this gene result in slow growth, tremors and hind leg weakness, collectively termed as the 'twitcher' phenotype. In humans, deficiency of this gene product causes a lysosomal storage disorder known as Krabbe disease. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for spontaneous and targeted mutations exhibit tremors, progressive weakness, wasting, both central and peripheral demyelination, massive accumulation of galactosylceramide, abnormal macrophages, and death by 4 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,110,681 V794M probably benign Het
Abca4 A T 3: 122,163,830 T772S probably damaging Het
Acox3 G A 5: 35,608,339 probably null Het
Adamts17 A G 7: 67,147,715 N1060S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Als2 T C 1: 59,174,991 Y1346C probably benign Het
Apol10b A T 15: 77,585,015 F321I probably benign Het
Atp5f1 A G 3: 105,951,589 probably null Het
Bloc1s5 A G 13: 38,619,084 probably benign Het
Btbd9 T C 17: 30,334,297 N397S possibly damaging Het
Cacna1d A G 14: 30,099,196 V1121A probably benign Het
Cad G A 5: 31,060,951 V460I probably damaging Het
Caprin2 A T 6: 148,843,121 D935E probably damaging Het
Ccdc150 A T 1: 54,354,636 K686N probably benign Het
Ccnt2 T C 1: 127,799,406 F186L possibly damaging Het
Cd5l G A 3: 87,367,880 probably null Het
Chrna7 A G 7: 63,099,252 V494A probably benign Het
Clec2i T G 6: 128,895,425 Y198* probably null Het
Col22a1 A G 15: 72,007,176 V44A probably damaging Het
Cspg4 T A 9: 56,886,979 I666N probably damaging Het
Cyp3a16 A T 5: 145,465,031 probably null Het
Dlk1 G T 12: 109,458,119 C102F probably damaging Het
Dscc1 T A 15: 55,084,139 H215L probably damaging Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Dus1l C G 11: 120,795,671 G15R probably benign Het
Eps8l1 G T 7: 4,471,823 V268L probably benign Het
F2 A C 2: 91,634,906 C104W probably damaging Het
F5 C A 1: 164,192,535 Q860K probably benign Het
Fmn2 T C 1: 174,502,266 L74P unknown Het
Frmd6 G A 12: 70,893,622 R347Q possibly damaging Het
Gabbr1 T G 17: 37,054,767 S158A probably damaging Het
Gm436 A G 4: 144,669,959 V401A probably benign Het
Gm6408 A T 5: 146,482,322 N49I probably damaging Het
Grm1 T A 10: 11,079,866 T225S possibly damaging Het
Grm8 C T 6: 27,285,867 V849I possibly damaging Het
Hmcn2 A G 2: 31,314,590 D59G probably damaging Het
Iars G A 13: 49,723,077 probably null Het
Ifi27 C T 12: 103,437,682 A127V possibly damaging Het
Ikbip A G 10: 91,096,481 N329S probably damaging Het
Ikbke T C 1: 131,265,877 T479A probably benign Het
Krt12 T A 11: 99,416,060 N472I probably damaging Het
Lmnb2 A T 10: 80,907,191 L193Q probably damaging Het
Lrriq4 T C 3: 30,650,252 V128A probably benign Het
Map4k4 C A 1: 40,000,757 probably benign Het
Mtmr7 T C 8: 40,551,811 T575A probably benign Het
Myh13 G A 11: 67,334,576 A256T probably benign Het
Napepld A G 5: 21,683,410 Y14H probably benign Het
Npr1 T C 3: 90,459,337 T552A probably damaging Het
Nudt15 A G 14: 73,521,647 F127S probably benign Het
Nwd2 T A 5: 63,808,271 S1733T probably benign Het
Olfr1189 A G 2: 88,592,436 I211V probably benign Het
Olfr1257 G A 2: 89,881,129 G101E probably damaging Het
Olfr1348 T G 7: 6,501,441 I262L probably benign Het
Olfr907 A G 9: 38,499,038 Y123C probably damaging Het
Olfr96 T C 17: 37,225,430 F102L probably benign Het
Paqr7 A T 4: 134,507,098 I89F probably benign Het
Pidd1 C A 7: 141,439,630 V706L probably benign Het
Polr3c A T 3: 96,713,595 I469N probably damaging Het
Ppip5k1 A G 2: 121,348,547 Y233H probably damaging Het
Psmc3 A G 2: 91,055,995 T166A possibly damaging Het
Ptchd3 A T 11: 121,842,542 I753L probably benign Het
Rad21 T C 15: 51,978,170 K50R probably damaging Het
Rad54b A G 4: 11,604,989 E479G possibly damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rgs20 C T 1: 4,910,640 R154Q probably damaging Het
Sbf1 T C 15: 89,294,425 D1449G probably damaging Het
Sema4g C T 19: 45,001,605 R708* probably null Het
Sept9 T C 11: 117,290,428 I18T probably benign Het
Serpinb6b A G 13: 32,978,058 E280G probably damaging Het
Slamf6 T C 1: 171,942,587 probably benign Het
Slc6a21 G A 7: 45,287,734 W554* probably null Het
Slco1a4 A C 6: 141,812,731 I518R probably benign Het
Stab1 T A 14: 31,168,416 Q26L probably benign Het
Stox1 A G 10: 62,667,965 F104L probably damaging Het
Suco T C 1: 161,834,949 K638E possibly damaging Het
Synpo T C 18: 60,602,784 K458E probably damaging Het
Szt2 A T 4: 118,372,368 W2820R unknown Het
Tmtc1 C A 6: 148,294,618 G499W probably damaging Het
Tonsl A C 15: 76,638,066 S242R probably damaging Het
Trpc4 G T 3: 54,194,822 S47I possibly damaging Het
Zfp106 G A 2: 120,520,428 R1581C probably benign Het
Zfp27 A G 7: 29,895,376 L388P possibly damaging Het
Other mutations in Galc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Galc APN 12 98231422 missense probably benign
IGL01287:Galc APN 12 98246244 unclassified probably benign
IGL01618:Galc APN 12 98252081 missense possibly damaging 0.92
IGL02125:Galc APN 12 98231509 missense probably damaging 1.00
IGL02274:Galc APN 12 98254214 nonsense probably null
IGL02392:Galc APN 12 98207413 missense probably damaging 0.99
IGL02478:Galc APN 12 98213132 missense possibly damaging 0.96
IGL02544:Galc APN 12 98231442 missense probably benign 0.27
IGL03268:Galc APN 12 98222593 splice site probably benign
IGL03327:Galc APN 12 98207476 splice site probably benign
Crabby2 UTSW 12 98234266 missense probably damaging 1.00
Krabbe UTSW 12 98222647 missense probably damaging 1.00
lobster UTSW 12 98246255 missense probably null 0.84
quake UTSW 12 98242714 missense probably damaging 1.00
teeter UTSW 12 98259162 missense probably damaging 1.00
R0218:Galc UTSW 12 98222647 missense probably damaging 1.00
R0240:Galc UTSW 12 98252034 missense probably damaging 1.00
R0240:Galc UTSW 12 98252034 missense probably damaging 1.00
R0467:Galc UTSW 12 98242645 missense probably damaging 1.00
R1619:Galc UTSW 12 98234304 missense probably benign 0.00
R1832:Galc UTSW 12 98234240 critical splice donor site probably null
R1844:Galc UTSW 12 98246297 splice site probably null
R1996:Galc UTSW 12 98252026 missense probably damaging 1.00
R2010:Galc UTSW 12 98254230 missense possibly damaging 0.51
R2097:Galc UTSW 12 98252032 missense probably benign
R2496:Galc UTSW 12 98227281 missense probably damaging 1.00
R2881:Galc UTSW 12 98213096 missense probably benign
R3009:Galc UTSW 12 98203969 missense probably damaging 1.00
R4571:Galc UTSW 12 98222617 missense probably benign 0.00
R4764:Galc UTSW 12 98242744 missense possibly damaging 0.78
R4851:Galc UTSW 12 98227274 missense probably benign 0.00
R4854:Galc UTSW 12 98256877 missense probably damaging 1.00
R4900:Galc UTSW 12 98231472 missense probably damaging 1.00
R4983:Galc UTSW 12 98242768 nonsense probably null
R5220:Galc UTSW 12 98231413 splice site probably null
R5273:Galc UTSW 12 98252071 missense probably damaging 1.00
R5495:Galc UTSW 12 98231414 critical splice donor site probably null
R5689:Galc UTSW 12 98212986 missense possibly damaging 0.94
R5819:Galc UTSW 12 98216261 missense probably benign 0.06
R6191:Galc UTSW 12 98252034 missense probably damaging 1.00
R6196:Galc UTSW 12 98259162 missense probably damaging 1.00
R6305:Galc UTSW 12 98259290 missense possibly damaging 0.57
R6335:Galc UTSW 12 98242714 missense probably damaging 1.00
R7255:Galc UTSW 12 98246255 missense probably null 0.84
R7496:Galc UTSW 12 98259238 nonsense probably null
R7704:Galc UTSW 12 98208843 missense probably benign
R8871:Galc UTSW 12 98246284 missense probably damaging 1.00
R9124:Galc UTSW 12 98254164 critical splice donor site probably null
R9140:Galc UTSW 12 98207414 missense probably null 0.55
R9211:Galc UTSW 12 98207440 missense probably benign 0.00
R9220:Galc UTSW 12 98254264 missense probably damaging 1.00
R9718:Galc UTSW 12 98259314 missense
Predicted Primers PCR Primer
(F):5'- TACTGCCTGAGTACACTGTACCCC -3'
(R):5'- TTCACCAGTGACTACACATGCATCC -3'

Sequencing Primer
(F):5'- CTGAGTACACTGTACCCCAATAG -3'
(R):5'- cttcttcttcttctccttcttcttc -3'
Posted On 2014-05-23