Mutagenetix > Incidental Mutations

Incidental Mutation 'R1763:Stab1'

193224

Institutional Source

Beutler Lab

Gene Symbol

Stab1

Ensembl Gene

ENSMUSG00000042286

Gene Name

stabilin 1

Synonyms

MS-1

MMRRC Submission

039795-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1763 (G1)

Quality Score

207

Status

Validated

Chromosome

Chromosomal Location

31139013-31168641 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 31168416 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 26 (Q26L)

Ref Sequence

ENSEMBL: ENSMUSP00000046199 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022469] [ENSMUST00000036618] [ENSMUST00000167449] [ENSMUST00000168206] [ENSMUST00000169628]

Predicted Effect

probably benign
Transcript: ENSMUST00000022469

SMART Domains

Protein: ENSMUSP00000022469
Gene: ENSMUSG00000021910

Domain	Start	End	E-Value	Type
PX	15	119	2.17e-26	SMART
PDB:4PQ8\|A	287	420	9e-8	PDB
SCOP:d1h6ta2	291	421	6e-29	SMART
Blast:LRR	311	332	5e-6	BLAST
Blast:LRR	333	355	6e-6	BLAST
Blast:LRR	378	403	5e-7	BLAST
Blast:LRR	403	429	6e-7	BLAST
low complexity region	489	501	N/A	INTRINSIC
low complexity region	517	534	N/A	INTRINSIC
coiled coil region	625	650	N/A	INTRINSIC
low complexity region	662	695	N/A	INTRINSIC
low complexity region	1038	1069	N/A	INTRINSIC
low complexity region	1081	1193	N/A	INTRINSIC
low complexity region	1491	1509	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000036618
AA Change: Q26L

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286
AA Change: Q26L

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	112	149	6.65e-2	SMART
EGF	160	194	2.28e0	SMART
EGF	199	232	1.4e0	SMART
EGF	236	272	4.97e-1	SMART
EGF	276	319	1.95e1	SMART
EGF_like	321	357	5.03e1	SMART
low complexity region	400	413	N/A	INTRINSIC
Blast:FAS1	414	501	2e-52	BLAST
FAS1	543	645	1.35e-24	SMART
EGF_like	780	817	5.45e1	SMART
EGF	822	861	1.08e-1	SMART
EGF	865	904	3.15e-3	SMART
EGF	908	947	1.3e1	SMART
EGF	951	989	1.47e1	SMART
FAS1	1023	1122	1.3e-17	SMART
FAS1	1165	1257	2.94e0	SMART
EGF	1332	1369	1.4e0	SMART
EGF	1379	1413	1.88e-1	SMART
EGF	1420	1455	6.02e0	SMART
EGF	1459	1497	3.82e-2	SMART
EGF	1501	1540	2.05e-2	SMART
EGF	1544	1583	2.25e1	SMART
FAS1	1616	1712	1.61e-22	SMART
FAS1	1763	1868	2.12e-17	SMART
EGF	1970	2007	1.26e-2	SMART
EGF	2017	2051	1.61e0	SMART
EGF	2059	2090	2.45e0	SMART
EGF	2094	2131	3.46e0	SMART
EGF	2135	2174	3.82e-2	SMART
LINK	2206	2301	8.55e-49	SMART
FAS1	2367	2462	2.06e-6	SMART
transmembrane domain	2476	2498	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159532

Predicted Effect

probably benign
Transcript: ENSMUST00000167449

Predicted Effect

probably benign
Transcript: ENSMUST00000168206

SMART Domains

Protein: ENSMUSP00000132842
Gene: ENSMUSG00000021910

Domain	Start	End	E-Value	Type
Pfam:LRR_8	44	101	3.9e-9	PFAM
Pfam:LRR_1	45	66	2.6e-2	PFAM
Pfam:LRR_6	88	109	1.1e-2	PFAM
Pfam:LRR_4	89	132	6.5e-8	PFAM
Pfam:LRR_1	90	109	6.9e-2	PFAM
Blast:LRR	133	158	4e-7	BLAST
Blast:LRR	158	184	6e-7	BLAST
low complexity region	244	256	N/A	INTRINSIC
low complexity region	272	289	N/A	INTRINSIC
coiled coil region	380	405	N/A	INTRINSIC
low complexity region	417	450	N/A	INTRINSIC
low complexity region	793	824	N/A	INTRINSIC
low complexity region	836	948	N/A	INTRINSIC
low complexity region	1246	1264	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169628

SMART Domains

Protein: ENSMUSP00000131465
Gene: ENSMUSG00000021910

Domain	Start	End	E-Value	Type
low complexity region	231	249	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170253

SMART Domains

Protein: ENSMUSP00000129547
Gene: ENSMUSG00000021910

Domain	Start	End	E-Value	Type
SCOP:d1dcea3	2	86	3e-11	SMART
Blast:LRR	13	34	1e-5	BLAST
Blast:LRR	35	60	1e-7	BLAST
Blast:LRR	60	86	2e-8	BLAST

Meta Mutation Damage Score

0.1992

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 92.0%

Validation Efficiency

98% (85/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no physical or behavioral abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	G	A	3: 122,110,681	V794M	probably benign	Het
Abca4	A	T	3: 122,163,830	T772S	probably damaging	Het
Acox3	G	A	5: 35,608,339		probably null	Het
Adamts17	A	G	7: 67,147,715	N1060S	probably damaging	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Als2	T	C	1: 59,174,991	Y1346C	probably benign	Het
Apol10b	A	T	15: 77,585,015	F321I	probably benign	Het
Atp5f1	A	G	3: 105,951,589		probably null	Het
Bloc1s5	A	G	13: 38,619,084		probably benign	Het
Btbd9	T	C	17: 30,334,297	N397S	possibly damaging	Het
Cacna1d	A	G	14: 30,099,196	V1121A	probably benign	Het
Cad	G	A	5: 31,060,951	V460I	probably damaging	Het
Caprin2	A	T	6: 148,843,121	D935E	probably damaging	Het
Ccdc150	A	T	1: 54,354,636	K686N	probably benign	Het
Ccnt2	T	C	1: 127,799,406	F186L	possibly damaging	Het
Cd5l	G	A	3: 87,367,880		probably null	Het
Chrna7	A	G	7: 63,099,252	V494A	probably benign	Het
Clec2i	T	G	6: 128,895,425	Y198*	probably null	Het
Col22a1	A	G	15: 72,007,176	V44A	probably damaging	Het
Cspg4	T	A	9: 56,886,979	I666N	probably damaging	Het
Cyp3a16	A	T	5: 145,465,031		probably null	Het
Dlk1	G	T	12: 109,458,119	C102F	probably damaging	Het
Dscc1	T	A	15: 55,084,139	H215L	probably damaging	Het
Dscc1	CTGAATGAAT	CTGAAT	15: 55,080,176		probably benign	Het
Dus1l	C	G	11: 120,795,671	G15R	probably benign	Het
Eps8l1	G	T	7: 4,471,823	V268L	probably benign	Het
F2	A	C	2: 91,634,906	C104W	probably damaging	Het
F5	C	A	1: 164,192,535	Q860K	probably benign	Het
Fmn2	T	C	1: 174,502,266	L74P	unknown	Het
Frmd6	G	A	12: 70,893,622	R347Q	possibly damaging	Het
Gabbr1	T	G	17: 37,054,767	S158A	probably damaging	Het
Galc	T	C	12: 98,234,266	N295S	probably damaging	Het
Gm436	A	G	4: 144,669,959	V401A	probably benign	Het
Gm6408	A	T	5: 146,482,322	N49I	probably damaging	Het
Grm1	T	A	10: 11,079,866	T225S	possibly damaging	Het
Grm8	C	T	6: 27,285,867	V849I	possibly damaging	Het
Hmcn2	A	G	2: 31,314,590	D59G	probably damaging	Het
Iars	G	A	13: 49,723,077		probably null	Het
Ifi27	C	T	12: 103,437,682	A127V	possibly damaging	Het
Ikbip	A	G	10: 91,096,481	N329S	probably damaging	Het
Ikbke	T	C	1: 131,265,877	T479A	probably benign	Het
Krt12	T	A	11: 99,416,060	N472I	probably damaging	Het
Lmnb2	A	T	10: 80,907,191	L193Q	probably damaging	Het
Lrriq4	T	C	3: 30,650,252	V128A	probably benign	Het
Map4k4	C	A	1: 40,000,757		probably benign	Het
Mtmr7	T	C	8: 40,551,811	T575A	probably benign	Het
Myh13	G	A	11: 67,334,576	A256T	probably benign	Het
Napepld	A	G	5: 21,683,410	Y14H	probably benign	Het
Npr1	T	C	3: 90,459,337	T552A	probably damaging	Het
Nudt15	A	G	14: 73,521,647	F127S	probably benign	Het
Nwd2	T	A	5: 63,808,271	S1733T	probably benign	Het
Olfr1189	A	G	2: 88,592,436	I211V	probably benign	Het
Olfr1257	G	A	2: 89,881,129	G101E	probably damaging	Het
Olfr1348	T	G	7: 6,501,441	I262L	probably benign	Het
Olfr907	A	G	9: 38,499,038	Y123C	probably damaging	Het
Olfr96	T	C	17: 37,225,430	F102L	probably benign	Het
Paqr7	A	T	4: 134,507,098	I89F	probably benign	Het
Pidd1	C	A	7: 141,439,630	V706L	probably benign	Het
Polr3c	A	T	3: 96,713,595	I469N	probably damaging	Het
Ppip5k1	A	G	2: 121,348,547	Y233H	probably damaging	Het
Psmc3	A	G	2: 91,055,995	T166A	possibly damaging	Het
Ptchd3	A	T	11: 121,842,542	I753L	probably benign	Het
Rad21	T	C	15: 51,978,170	K50R	probably damaging	Het
Rad54b	A	G	4: 11,604,989	E479G	possibly damaging	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Rgs20	C	T	1: 4,910,640	R154Q	probably damaging	Het
Sbf1	T	C	15: 89,294,425	D1449G	probably damaging	Het
Sema4g	C	T	19: 45,001,605	R708*	probably null	Het
Sept9	T	C	11: 117,290,428	I18T	probably benign	Het
Serpinb6b	A	G	13: 32,978,058	E280G	probably damaging	Het
Slamf6	T	C	1: 171,942,587		probably benign	Het
Slc6a21	G	A	7: 45,287,734	W554*	probably null	Het
Slco1a4	A	C	6: 141,812,731	I518R	probably benign	Het
Stox1	A	G	10: 62,667,965	F104L	probably damaging	Het
Suco	T	C	1: 161,834,949	K638E	possibly damaging	Het
Synpo	T	C	18: 60,602,784	K458E	probably damaging	Het
Szt2	A	T	4: 118,372,368	W2820R	unknown	Het
Tmtc1	C	A	6: 148,294,618	G499W	probably damaging	Het
Tonsl	A	C	15: 76,638,066	S242R	probably damaging	Het
Trpc4	G	T	3: 54,194,822	S47I	possibly damaging	Het
Zfp106	G	A	2: 120,520,428	R1581C	probably benign	Het
Zfp27	A	G	7: 29,895,376	L388P	possibly damaging	Het

Other mutations in Stab1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Stab1	APN	14	31161357	missense	probably benign	0.01
IGL00323:Stab1	APN	14	31139306	missense	probably benign	0.04
IGL00515:Stab1	APN	14	31159729	missense	probably benign	0.20
IGL00844:Stab1	APN	14	31147066	missense	probably damaging	1.00
IGL01374:Stab1	APN	14	31147075	missense	probably damaging	1.00
IGL01384:Stab1	APN	14	31150408	missense	probably benign
IGL01431:Stab1	APN	14	31148995	missense	probably benign	0.06
IGL01787:Stab1	APN	14	31139808	missense	probably damaging	1.00
IGL02128:Stab1	APN	14	31150441	missense	probably damaging	1.00
IGL02138:Stab1	APN	14	31143513	critical splice donor site	probably null
IGL02256:Stab1	APN	14	31141592	missense	probably damaging	1.00
IGL02340:Stab1	APN	14	31140410	missense	probably damaging	0.96
IGL02507:Stab1	APN	14	31139210	unclassified	probably benign
IGL02695:Stab1	APN	14	31159271	missense	probably damaging	1.00
IGL02755:Stab1	APN	14	31139638	missense	probably benign	0.01
IGL02870:Stab1	APN	14	31139397	missense	probably benign	0.00
IGL02884:Stab1	APN	14	31150143	splice site	probably null
IGL03035:Stab1	APN	14	31147769	missense	probably benign	0.00
IGL03267:Stab1	APN	14	31142729	missense	probably damaging	1.00
IGL03286:Stab1	APN	14	31159326	splice site	probably benign
IGL03366:Stab1	APN	14	31150263	missense	possibly damaging	0.58
IGL03412:Stab1	APN	14	31154407	missense	probably benign	0.42
IGL02835:Stab1	UTSW	14	31146024	critical splice donor site	probably null
K7371:Stab1	UTSW	14	31150249	missense	probably damaging	1.00
R0053:Stab1	UTSW	14	31140687	missense	possibly damaging	0.57
R0053:Stab1	UTSW	14	31140687	missense	possibly damaging	0.57
R0066:Stab1	UTSW	14	31157070	splice site	probably benign
R0066:Stab1	UTSW	14	31157070	splice site	probably benign
R0363:Stab1	UTSW	14	31159008	splice site	probably benign
R0387:Stab1	UTSW	14	31148101	missense	probably benign	0.00
R0391:Stab1	UTSW	14	31143418	missense	probably benign	0.21
R0513:Stab1	UTSW	14	31148945	missense	probably benign	0.08
R0546:Stab1	UTSW	14	31139550	missense	possibly damaging	0.92
R0825:Stab1	UTSW	14	31152600	missense	probably benign	0.16
R0906:Stab1	UTSW	14	31145249	missense	probably benign	0.19
R0963:Stab1	UTSW	14	31147274	missense	probably damaging	0.97
R1219:Stab1	UTSW	14	31140621	splice site	probably null
R1234:Stab1	UTSW	14	31150236	missense	probably damaging	1.00
R1260:Stab1	UTSW	14	31151889	missense	probably damaging	1.00
R1400:Stab1	UTSW	14	31139830	missense	possibly damaging	0.92
R1405:Stab1	UTSW	14	31149001	missense	probably benign	0.19
R1405:Stab1	UTSW	14	31149001	missense	probably benign	0.19
R1440:Stab1	UTSW	14	31151690	nonsense	probably null
R1472:Stab1	UTSW	14	31141586	missense	probably benign	0.01
R1474:Stab1	UTSW	14	31149861	missense	probably benign	0.45
R1475:Stab1	UTSW	14	31163828	missense	probably benign
R1509:Stab1	UTSW	14	31151584	splice site	probably benign
R1551:Stab1	UTSW	14	31160499	missense	probably benign	0.00
R1572:Stab1	UTSW	14	31150823	missense	probably damaging	1.00
R1633:Stab1	UTSW	14	31150380	splice site	probably null
R1719:Stab1	UTSW	14	31146028	nonsense	probably null
R1733:Stab1	UTSW	14	31145303	missense	probably damaging	1.00
R1808:Stab1	UTSW	14	31141144	missense	possibly damaging	0.80
R1816:Stab1	UTSW	14	31157465	missense	probably benign	0.03
R1853:Stab1	UTSW	14	31140463	missense	probably damaging	1.00
R1891:Stab1	UTSW	14	31141330	missense	probably benign	0.07
R1984:Stab1	UTSW	14	31150648	missense	probably benign	0.20
R1998:Stab1	UTSW	14	31162153	nonsense	probably null
R2165:Stab1	UTSW	14	31168435	missense	probably benign	0.20
R2191:Stab1	UTSW	14	31142800	missense	probably benign	0.03
R2191:Stab1	UTSW	14	31159270	missense	probably damaging	1.00
R2233:Stab1	UTSW	14	31161880	missense	probably benign	0.08
R2303:Stab1	UTSW	14	31146070	missense	probably damaging	1.00
R2496:Stab1	UTSW	14	31161463	missense	probably damaging	1.00
R2504:Stab1	UTSW	14	31163040	critical splice donor site	probably null
R2519:Stab1	UTSW	14	31154872	missense	probably damaging	1.00
R2926:Stab1	UTSW	14	31161799	missense	probably damaging	1.00
R4025:Stab1	UTSW	14	31154952	missense	possibly damaging	0.46
R4113:Stab1	UTSW	14	31168479	missense	probably damaging	0.98
R4258:Stab1	UTSW	14	31154672	missense	possibly damaging	0.92
R4588:Stab1	UTSW	14	31157445	missense	probably benign	0.01
R4644:Stab1	UTSW	14	31140487	unclassified	probably benign
R4660:Stab1	UTSW	14	31154915	missense	possibly damaging	0.91
R4801:Stab1	UTSW	14	31141371	nonsense	probably null
R4802:Stab1	UTSW	14	31141371	nonsense	probably null
R4870:Stab1	UTSW	14	31142043	missense	probably benign	0.13
R4872:Stab1	UTSW	14	31140393	missense	probably damaging	1.00
R4881:Stab1	UTSW	14	31143672	missense	probably benign	0.32
R4941:Stab1	UTSW	14	31151571	missense	probably benign	0.00
R5061:Stab1	UTSW	14	31163099	missense	probably damaging	1.00
R5086:Stab1	UTSW	14	31143624	missense	probably damaging	1.00
R5086:Stab1	UTSW	14	31159304	missense	probably damaging	1.00
R5087:Stab1	UTSW	14	31159304	missense	probably damaging	1.00
R5092:Stab1	UTSW	14	31145855	missense	probably benign	0.01
R5102:Stab1	UTSW	14	31148017	critical splice donor site	probably null
R5107:Stab1	UTSW	14	31163795	splice site	probably null
R5195:Stab1	UTSW	14	31140521	unclassified	probably benign
R5217:Stab1	UTSW	14	31159519	missense	probably benign	0.25
R5285:Stab1	UTSW	14	31143476	unclassified	probably benign
R5327:Stab1	UTSW	14	31161836	nonsense	probably null
R5647:Stab1	UTSW	14	31157440	nonsense	probably null
R5696:Stab1	UTSW	14	31160221	missense	probably benign
R5996:Stab1	UTSW	14	31139551	missense	probably benign	0.39
R6016:Stab1	UTSW	14	31158993	missense	probably damaging	1.00
R6017:Stab1	UTSW	14	31141544	missense	probably benign	0.00
R6174:Stab1	UTSW	14	31162519	nonsense	probably null
R6366:Stab1	UTSW	14	31141438	missense	probably benign	0.10
R6754:Stab1	UTSW	14	31141081	missense	probably benign
R6788:Stab1	UTSW	14	31139160	missense	probably damaging	1.00
R6898:Stab1	UTSW	14	31158963	missense	probably benign	0.00
R7124:Stab1	UTSW	14	31160867	missense	possibly damaging	0.94
R7145:Stab1	UTSW	14	31145073	critical splice donor site	probably null
R7153:Stab1	UTSW	14	31160584	missense	probably benign	0.16
R7213:Stab1	UTSW	14	31143673	missense	probably benign
R7215:Stab1	UTSW	14	31160797	missense	possibly damaging	0.93
R7319:Stab1	UTSW	14	31140826	missense	probably damaging	1.00
R7389:Stab1	UTSW	14	31147239	missense	probably benign	0.00
R7400:Stab1	UTSW	14	31157384	missense	probably null	1.00
R7427:Stab1	UTSW	14	31159259	missense	probably benign	0.00
R7428:Stab1	UTSW	14	31159259	missense	probably benign	0.00
R7484:Stab1	UTSW	14	31160317	missense	probably benign	0.00
R7568:Stab1	UTSW	14	31152595	missense	probably damaging	1.00
R7574:Stab1	UTSW	14	31154665	missense	probably benign
R7619:Stab1	UTSW	14	31145237	missense	probably benign
R7623:Stab1	UTSW	14	31140621	missense	probably benign	0.03
R7721:Stab1	UTSW	14	31141456	missense	possibly damaging	0.48
R7869:Stab1	UTSW	14	31154472	missense	probably benign	0.01
R7936:Stab1	UTSW	14	31157415	missense	possibly damaging	0.88
R7956:Stab1	UTSW	14	31160024	missense	probably benign	0.02
R7973:Stab1	UTSW	14	31159633	critical splice donor site	probably null
R8059:Stab1	UTSW	14	31160241	missense	probably benign	0.02
R8116:Stab1	UTSW	14	31158953	missense	possibly damaging	0.80
R8304:Stab1	UTSW	14	31148954	missense	probably benign	0.14
R8368:Stab1	UTSW	14	31148411	missense	possibly damaging	0.91
R8513:Stab1	UTSW	14	31149790	critical splice donor site	probably null
X0026:Stab1	UTSW	14	31162191	missense	possibly damaging	0.91
Z1176:Stab1	UTSW	14	31142038	missense	probably benign	0.00
Z1176:Stab1	UTSW	14	31150660	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTAGAACAGCCGTAGACTTCAGCC -3'
(R):5'- GCTGCTGATACGCAGGAGGAAATC -3'

Sequencing Primer
(F):5'- CTTCAGCCTGGGGAGGTG -3'
(R):5'- CTGACGGATAGCTTTTAAAGCG -3'

Posted On

2014-05-23