Incidental Mutation 'R1862:Syne4'
ID204027
Institutional Source Beutler Lab
Gene Symbol Syne4
Ensembl Gene ENSMUSG00000019737
Gene Namespectrin repeat containing, nuclear envelope family member 4
Synonyms
MMRRC Submission 039885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1862 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30314807-30319046 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30316883 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 168 (V168A)
Ref Sequence ENSEMBL: ENSMUSP00000135895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054594] [ENSMUST00000060834] [ENSMUST00000098585] [ENSMUST00000098586] [ENSMUST00000136887] [ENSMUST00000137550] [ENSMUST00000176304] [ENSMUST00000176504] [ENSMUST00000176789] [ENSMUST00000177078]
Predicted Effect probably benign
Transcript: ENSMUST00000054594
AA Change: V216A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000055874
Gene: ENSMUSG00000019737
AA Change: V216A

DomainStartEndE-ValueType
Blast:SPEC 96 198 2e-34 BLAST
low complexity region 222 234 N/A INTRINSIC
low complexity region 290 315 N/A INTRINSIC
KASH 335 388 2.85e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060834
SMART Domains Protein: ENSMUSP00000051515
Gene: ENSMUSG00000042831

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 23 224 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098585
SMART Domains Protein: ENSMUSP00000096184
Gene: ENSMUSG00000074210

DomainStartEndE-ValueType
low complexity region 74 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098586
SMART Domains Protein: ENSMUSP00000096185
Gene: ENSMUSG00000074211

DomainStartEndE-ValueType
Pfam:Complex1_LYR 9 63 2.1e-16 PFAM
Pfam:Complex1_LYR_1 9 65 5.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135882
Predicted Effect probably benign
Transcript: ENSMUST00000136887
SMART Domains Protein: ENSMUSP00000121953
Gene: ENSMUSG00000042831

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 3 210 2.1e-16 PFAM
Pfam:2OG-FeII_Oxy 82 213 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176253
Predicted Effect probably benign
Transcript: ENSMUST00000176304
SMART Domains Protein: ENSMUSP00000135637
Gene: ENSMUSG00000019737

DomainStartEndE-ValueType
Blast:SPEC 96 196 3e-34 BLAST
low complexity region 197 232 N/A INTRINSIC
KASH 252 305 2.85e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176504
AA Change: V188A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000135844
Gene: ENSMUSG00000019737
AA Change: V188A

DomainStartEndE-ValueType
Blast:SPEC 92 170 2e-33 BLAST
low complexity region 194 206 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176536
Predicted Effect probably benign
Transcript: ENSMUST00000176571
Predicted Effect probably benign
Transcript: ENSMUST00000176789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176987
Predicted Effect probably benign
Transcript: ENSMUST00000177078
AA Change: V168A

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135895
Gene: ENSMUSG00000019737
AA Change: V168A

DomainStartEndE-ValueType
Blast:SPEC 88 150 4e-24 BLAST
low complexity region 174 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177395
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nesprin family of genes, that encode KASH (Klarsicht, Anc-1, Syne Homology) domain-containing proteins. In addition to the KASH domain, this protein also contains a coiled-coil and leucine zipper region, a spectrin repeat, and a kinesin-1 binding region. This protein localizes to the outer nuclear membrane, and is part of the linker of nucleoskeleton and cytoskeleton (LINC) complex in the nuclear envelope. LINC complexes are formed by SUN (Sad1, UNC-84)-KASH pairs, and are thought to mechanically couple nuclear components to the cytoskeleton. Mutations in this gene have been associated with progressive high-frequency hearing loss. The absence of this protein in mice also caused hearing loss, and changes in hair cell morphology in the ears. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss associated with outer hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 E565D probably benign Het
Adam30 A T 3: 98,162,113 K421* probably null Het
Atp6v1b1 A G 6: 83,749,852 probably null Het
Cacna1a A T 8: 84,415,930 I96F possibly damaging Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Cdh8 T A 8: 99,190,394 D363V probably damaging Het
Cecr2 T C 6: 120,757,941 Y685H probably damaging Het
Cmklr1 T C 5: 113,614,407 T178A probably damaging Het
Col16a1 G A 4: 130,092,782 probably null Het
Col4a1 C T 8: 11,226,439 probably benign Het
Coro2a T A 4: 46,548,797 I166F possibly damaging Het
Cry2 T C 2: 92,424,566 H148R probably damaging Het
Crygd T C 1: 65,061,974 Y154C probably benign Het
Cubn T C 2: 13,308,561 Y3066C probably damaging Het
Defb15 C T 8: 21,929,986 E42K possibly damaging Het
Dnah12 A G 14: 26,697,398 D147G probably benign Het
Dnah12 A T 14: 26,709,257 Y340F probably benign Het
Dot1l G T 10: 80,783,539 R193L probably damaging Het
Dupd1 A G 14: 21,686,689 V115A probably benign Het
Esd A C 14: 74,742,074 Y119S probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Etfbkmt T A 6: 149,144,151 M1K probably null Het
Exph5 A G 9: 53,376,248 H1543R probably benign Het
Fam92a C T 4: 12,155,717 V306I possibly damaging Het
Fbxo16 A G 14: 65,270,803 T23A probably damaging Het
Gm11492 A G 11: 87,567,235 H145R possibly damaging Het
Gm6614 T C 6: 142,003,423 M76V possibly damaging Het
Gorasp2 C A 2: 70,679,464 H136Q probably damaging Het
Hdc T A 2: 126,597,933 I367F probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ilvbl A G 10: 78,584,124 D592G probably benign Het
Inmt G A 6: 55,174,883 A34V probably damaging Het
Ints9 A C 14: 65,026,413 H378P probably benign Het
Kcnh7 T A 2: 62,787,754 I464L possibly damaging Het
Kcnt2 T A 1: 140,425,330 V259D probably damaging Het
Lipo1 A G 19: 33,784,692 F135S probably damaging Het
Lrba T C 3: 86,773,203 probably null Het
Mapk1 T A 16: 17,026,429 S22T probably benign Het
Mbd3l2 T C 9: 18,444,921 S181P possibly damaging Het
Mgat5 C T 1: 127,459,969 P554L probably damaging Het
Mki67 T C 7: 135,699,361 T1315A probably benign Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Mroh3 T A 1: 136,185,988 I688F probably benign Het
Myo1d A T 11: 80,663,048 Y536N probably damaging Het
Neb C T 2: 52,162,187 probably null Het
Noc2l A G 4: 156,237,708 R161G probably benign Het
Nup54 T A 5: 92,419,567 I375L possibly damaging Het
Nup93 T C 8: 94,306,102 F539L probably damaging Het
Olfr138 A G 17: 38,275,344 E191G probably damaging Het
Olfr417 T A 1: 174,369,452 H178Q probably damaging Het
Olfr480 A C 7: 108,066,725 Y24* probably null Het
Olfr874 T A 9: 37,746,968 M278K probably benign Het
Panx1 A T 9: 15,007,428 D378E probably damaging Het
Papss1 T A 3: 131,583,184 V170D possibly damaging Het
Pcnx T C 12: 81,918,732 S558P probably damaging Het
Pde3a T A 6: 141,250,353 I255N probably damaging Het
Pde3a G T 6: 141,487,513 A757S probably damaging Het
Pdzph1 A G 17: 58,922,583 Y1027H probably damaging Het
Pkhd1 G T 1: 20,551,020 R805S probably benign Het
Polr1a G A 6: 71,909,203 G14D probably damaging Het
Prg4 T A 1: 150,460,669 D60V probably damaging Het
Ptprc T C 1: 138,112,227 S311G probably benign Het
Rapgefl1 G A 11: 98,842,209 R205K probably benign Het
Rcan2 A T 17: 44,037,089 probably null Het
Rock1 A G 18: 10,079,207 I1087T probably damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Setd1b T C 5: 123,147,613 S241P unknown Het
Srpk2 T C 5: 23,524,150 K497R probably benign Het
Sspo T C 6: 48,491,006 S4296P probably damaging Het
Tank T C 2: 61,649,912 F264S probably damaging Het
Ticrr T C 7: 79,695,207 S1607P probably damaging Het
Trim30a A G 7: 104,411,198 V457A probably damaging Het
Trim43b T A 9: 89,085,571 K336N probably damaging Het
Trim47 T C 11: 116,106,137 Q598R probably damaging Het
Tspan12 T C 6: 21,851,023 N18S probably damaging Het
Ubap2 A G 4: 41,221,607 S231P probably benign Het
Vit A G 17: 78,622,746 D380G probably damaging Het
Vmn2r2 T C 3: 64,134,521 N258D possibly damaging Het
Vmn2r52 C T 7: 10,173,406 C131Y possibly damaging Het
Zadh2 T C 18: 84,095,318 V373A possibly damaging Het
Zfp58 A T 13: 67,491,188 F395I probably damaging Het
Zfp940 C A 7: 29,845,010 G491C probably damaging Het
Other mutations in Syne4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Syne4 APN 7 30316563 splice site probably null
IGL02386:Syne4 APN 7 30316234 missense possibly damaging 0.91
R0089:Syne4 UTSW 7 30318919 missense probably damaging 0.99
R0091:Syne4 UTSW 7 30318919 missense probably damaging 0.99
R0448:Syne4 UTSW 7 30314920 start gained probably benign
R0555:Syne4 UTSW 7 30316744 missense probably damaging 0.99
R1205:Syne4 UTSW 7 30315336 missense probably damaging 0.96
R1863:Syne4 UTSW 7 30316883 missense probably benign 0.06
R4776:Syne4 UTSW 7 30316833 splice site probably benign
R5325:Syne4 UTSW 7 30318976 missense probably damaging 1.00
R6145:Syne4 UTSW 7 30316563 splice site probably null
R6479:Syne4 UTSW 7 30316915 nonsense probably null
Z1088:Syne4 UTSW 7 30316336 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCATCTTCCAACGGCTCTG -3'
(R):5'- CAAGTAGGGAGCCTTTGAGG -3'

Sequencing Primer
(F):5'- GCTCTGGCAGCTGCAGG -3'
(R):5'- GCTGATCTCACCTCAAGGC -3'
Posted On2014-06-23