Mutagenetix > Incidental Mutation

Incidental Mutation 'R0114:Cftr'

20639

Institutional Source

Beutler Lab

Gene Symbol

Cftr

Ensembl Gene

ENSMUSG00000041301

Gene Name

cystic fibrosis transmembrane conductance regulator

Synonyms

Abcc7

MMRRC Submission

038400-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.222) question?

Stock #

R0114 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

18170687-18322768 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 18282448 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1049 (H1049L)

Ref Sequence

ENSEMBL: ENSMUSP00000049228 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045706] [ENSMUST00000115405] [ENSMUST00000115406] [ENSMUST00000140407]

AlphaFold

P26361

PDB Structure

mouse CFTR NBD1 with AMP.PNP [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) apo [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ATP [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ADP [X-RAY DIFFRACTION]
Phosphorylated Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ATP [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ATP, I4122 space group [X-RAY DIFFRACTION]
Structure of NBD1 from murine CFTR- F508S mutant [X-RAY DIFFRACTION]
Structure of NBD1 from murine CFTR- F508R mutant [X-RAY DIFFRACTION]
The crystal structure of the NBD1 domain of the mouse CFTR protein, deltaF508 mutant [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000045706
AA Change: H1049L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000049228
Gene: ENSMUSG00000041301
AA Change: H1049L

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	3.7e-40	PFAM
AAA	450	623	2.16e-12	SMART
Pfam:CFTR_R	639	844	2e-93	PFAM
Pfam:ABC_membrane	857	1142	2.7e-53	PFAM
AAA	1232	1414	9.94e-12	SMART
low complexity region	1465	1474	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115405

SMART Domains

Protein: ENSMUSP00000111064
Gene: ENSMUSG00000041301

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	1.4e-48	PFAM
Pfam:ABC_tran	441	570	2.3e-19	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115406
AA Change: H1019L

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000111065
Gene: ENSMUSG00000041301
AA Change: H1019L

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	167	4e-14	PFAM
Pfam:ABC_membrane	162	320	2.5e-20	PFAM
AAA	420	593	2.16e-12	SMART
Pfam:CFTR_R	609	815	1.3e-97	PFAM
Pfam:ABC_membrane	827	1112	1e-50	PFAM
AAA	1202	1384	9.94e-12	SMART
low complexity region	1435	1444	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140407

SMART Domains

Protein: ENSMUSP00000116957
Gene: ENSMUSG00000041301

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	1.2e-48	PFAM
Pfam:ABC_tran	441	568	6.3e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143135

Meta Mutation Damage Score

0.8941

Coding Region Coverage

1x: 98.6%
3x: 97.4%
10x: 93.2%
20x: 79.2%

Validation Efficiency

100% (99/99)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This gene encodes the cystic fibrosis transmembrane regulator and a chloride channel that controls the regulation of other transport pathways. Mutations in this gene have been associated with autosomal recessive disorders such as cystic fibrosis and congenital bilateral aplasia of the vas deferens. Alternative splicing of exons 4, 5, and 11 have been observed, but full-length transcripts have not yet been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high mortality associated with intestinal obstruction, and altered mucous and serous glands. Mutants, like humans with cystic fibrosis, also exhibit defective epithelial chloride transport. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	T	C	10: 28,985,982		probably benign	Het
4933427D14Rik	T	C	11: 72,195,799	Y262C	probably damaging	Het
Adamts1	C	A	16: 85,799,614	V379L	probably benign	Het
Akt3	T	C	1: 177,067,251	D260G	probably damaging	Het
Alms1	T	C	6: 85,619,803	L537P	probably benign	Het
Anln	A	T	9: 22,353,346	I876N	probably damaging	Het
Ano9	A	T	7: 141,103,239		probably benign	Het
Arhgef10l	T	C	4: 140,583,883	E218G	probably benign	Het
Arnt2	G	A	7: 84,347,530	R63C	probably damaging	Het
Atp9a	G	T	2: 168,710,856	Y63*	probably null	Het
Bmpr2	G	T	1: 59,815,340	C116F	probably damaging	Het
Cand1	T	C	10: 119,216,522	D233G	probably benign	Het
Ckap5	A	T	2: 91,620,112	D1975V	possibly damaging	Het
Cyp26c1	T	C	19: 37,686,633	V134A	probably benign	Het
Dnaic1	T	C	4: 41,605,686		probably benign	Het
Dpp10	T	C	1: 123,486,092	I163V	probably benign	Het
Fam151a	A	T	4: 106,734,004	I15F	possibly damaging	Het
Fanca	A	T	8: 123,288,491		probably null	Het
Fes	A	G	7: 80,378,035	V787A	probably damaging	Het
Fnip1	C	T	11: 54,487,801		probably benign	Het
Gabpb1	A	G	2: 126,653,574	I86T	probably damaging	Het
Gm1840	A	G	8: 5,640,359		noncoding transcript	Het
Gmds	A	T	13: 32,227,281	S57T	probably benign	Het
Gnpat	T	G	8: 124,883,357	D426E	probably benign	Het
Gnptab	C	A	10: 88,433,400	P655Q	possibly damaging	Het
Herc1	T	A	9: 66,461,846	F2941I	probably damaging	Het
Herc2	T	C	7: 56,153,774		probably benign	Het
Ino80	G	A	2: 119,382,960	R1249C	probably damaging	Het
Itga11	T	G	9: 62,735,293	V166G	probably damaging	Het
Itga11	T	C	9: 62,760,302	V639A	possibly damaging	Het
Itpr2	A	G	6: 146,312,879	F1490S	probably damaging	Het
Lama2	C	A	10: 26,993,068	E802*	probably null	Het
Lgi3	C	T	14: 70,531,029		probably benign	Het
Limch1	C	T	5: 67,036,084		probably benign	Het
Lipc	T	C	9: 70,803,781	N363S	probably damaging	Het
Lrit2	A	G	14: 37,068,045		probably null	Het
Mfsd13a	C	T	19: 46,366,504	T40I	probably benign	Het
Mug2	A	G	6: 122,040,648	Y448C	probably damaging	Het
Mybpc3	A	G	2: 91,124,494	E450G	probably damaging	Het
Myo5b	A	T	18: 74,742,171	T1549S	probably benign	Het
Naa15	T	C	3: 51,448,438		probably null	Het
Nckap1l	T	A	15: 103,455,028	C54S	probably benign	Het
Nlrp9b	A	G	7: 20,024,056	D406G	probably benign	Het
Nprl3	T	A	11: 32,239,784		probably benign	Het
Nvl	A	G	1: 181,120,391	V429A	probably benign	Het
Olfr114	A	T	17: 37,589,415	*313K	probably null	Het
Olfr54	G	A	11: 51,027,604	V201I	probably benign	Het
Olfr548-ps1	A	T	7: 102,542,731	Q265L	probably benign	Het
Olfr801	T	A	10: 129,669,598	Y307F	probably benign	Het
Opa1	A	T	16: 29,629,635	N912Y	probably benign	Het
Pcnx	T	C	12: 81,996,095	V2317A	possibly damaging	Het
Phf3	A	T	1: 30,805,443	N1478K	possibly damaging	Het
Phykpl	G	A	11: 51,586,653	D91N	probably benign	Het
Polr2b	T	A	5: 77,343,263	C984S	probably damaging	Het
Ppfibp1	A	G	6: 146,998,233	R141G	probably benign	Het
Ppm1d	G	A	11: 85,326,905	G20R	probably damaging	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Ppp2r5b	C	A	19: 6,228,431	V483F	probably benign	Het
Ppp4r4	T	A	12: 103,576,374	C132S	probably benign	Het
Prg2	A	G	2: 84,983,456		probably benign	Het
Prpf4b	G	A	13: 34,890,488		probably benign	Het
Rad54l2	T	C	9: 106,713,455	T491A	probably damaging	Het
Rnf213	G	T	11: 119,414,587	W548L	probably damaging	Het
Rusc2	G	T	4: 43,422,055	C825F	probably damaging	Het
Sema4b	A	G	7: 80,219,078		probably benign	Het
Sema6a	A	G	18: 47,290,177	V254A	probably damaging	Het
Slc13a3	A	G	2: 165,424,581	F346L	probably damaging	Het
Slc25a17	T	C	15: 81,337,959	D104G	probably damaging	Het
Specc1	A	T	11: 62,146,313	N707Y	possibly damaging	Het
Tex48	T	A	4: 63,608,459	E76V	probably damaging	Het
Tfr2	T	C	5: 137,577,465	V281A	probably benign	Het
Tgfb1i1	A	C	7: 128,249,494	Q238H	probably damaging	Het
Thoc6	G	A	17: 23,670,239	T122I	probably benign	Het
Tmtc1	G	A	6: 148,412,830		probably benign	Het
Tnfrsf8	T	C	4: 145,288,047	D264G	possibly damaging	Het
Trim43a	T	A	9: 88,584,160	I178N	probably damaging	Het
Ttn	G	C	2: 76,707,093	I26503M	possibly damaging	Het
Usp28	C	A	9: 49,039,023	D589E	probably benign	Het
Utp23	T	C	15: 51,882,511	S242P	probably damaging	Het
Vwa3a	A	G	7: 120,775,380	Y305C	probably benign	Het
Vwa5b1	C	A	4: 138,608,858	E142*	probably null	Het
Xrn2	A	T	2: 147,029,779	T374S	probably damaging	Het
Zfp735	A	T	11: 73,710,662	Q144L	probably benign	Het

Other mutations in Cftr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00901:Cftr	APN	6	18268430	critical splice donor site	probably null
IGL01082:Cftr	APN	6	18226103	missense	probably damaging	0.97
IGL01113:Cftr	APN	6	18270253	missense	probably damaging	1.00
IGL01383:Cftr	APN	6	18226041	missense	probably benign	0.00
IGL01595:Cftr	APN	6	18198239	splice site	probably benign
IGL01820:Cftr	APN	6	18226139	missense	probably damaging	1.00
IGL02223:Cftr	APN	6	18221482	missense	probably damaging	1.00
IGL02249:Cftr	APN	6	18277871	missense	possibly damaging	0.58
IGL02439:Cftr	APN	6	18258238	nonsense	probably null
IGL02537:Cftr	APN	6	18274597	missense	probably benign	0.31
IGL03234:Cftr	APN	6	18225988	missense	probably damaging	0.96
BB004:Cftr	UTSW	6	18267971	missense	possibly damaging	0.81
BB014:Cftr	UTSW	6	18267971	missense	possibly damaging	0.81
PIT4453001:Cftr	UTSW	6	18214106	missense	probably damaging	0.99
PIT4520001:Cftr	UTSW	6	18277843	missense	probably benign	0.01
R0329:Cftr	UTSW	6	18226097	missense	probably null	1.00
R0330:Cftr	UTSW	6	18226097	missense	probably null	1.00
R0331:Cftr	UTSW	6	18235226	missense	possibly damaging	0.72
R0480:Cftr	UTSW	6	18274518	splice site	probably benign
R0612:Cftr	UTSW	6	18198126	missense	probably benign	0.01
R0633:Cftr	UTSW	6	18305980	missense	probably damaging	0.99
R0830:Cftr	UTSW	6	18270225	missense	probably benign	0.02
R1559:Cftr	UTSW	6	18225937	missense	probably benign	0.01
R1629:Cftr	UTSW	6	18226106	missense	probably damaging	1.00
R1636:Cftr	UTSW	6	18226157	missense	probably damaging	0.99
R1860:Cftr	UTSW	6	18268289	missense	probably benign	0.00
R2043:Cftr	UTSW	6	18320935	missense	probably benign
R2211:Cftr	UTSW	6	18214280	missense	probably null	0.13
R4737:Cftr	UTSW	6	18299883	missense	probably benign	0.19
R4793:Cftr	UTSW	6	18226088	missense	probably damaging	1.00
R4857:Cftr	UTSW	6	18320975	missense	possibly damaging	0.92
R4984:Cftr	UTSW	6	18235199	missense	possibly damaging	0.89
R4999:Cftr	UTSW	6	18221614	missense	probably benign	0.17
R5045:Cftr	UTSW	6	18230081	missense	probably benign	0.20
R5183:Cftr	UTSW	6	18299833	missense	probably damaging	0.99
R5197:Cftr	UTSW	6	18255414	missense	probably benign	0.00
R5288:Cftr	UTSW	6	18226129	nonsense	probably null
R5337:Cftr	UTSW	6	18319059	missense	probably damaging	1.00
R5549:Cftr	UTSW	6	18227954	missense	probably benign	0.00
R5596:Cftr	UTSW	6	18268096	missense	probably benign	0.00
R5651:Cftr	UTSW	6	18255365	splice site	probably null
R5660:Cftr	UTSW	6	18313687	missense	probably benign	0.22
R5941:Cftr	UTSW	6	18313646	missense	probably damaging	1.00
R6221:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6222:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6229:Cftr	UTSW	6	18220684	missense	probably damaging	1.00
R6256:Cftr	UTSW	6	18274661	missense	probably damaging	0.96
R6257:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6412:Cftr	UTSW	6	18285604	missense	probably damaging	0.97
R6459:Cftr	UTSW	6	18258236	missense	probably damaging	1.00
R6558:Cftr	UTSW	6	18222528	missense	probably damaging	1.00
R6724:Cftr	UTSW	6	18255974	nonsense	probably null
R6787:Cftr	UTSW	6	18274608	nonsense	probably null
R6861:Cftr	UTSW	6	18268108	missense	probably benign	0.00
R6888:Cftr	UTSW	6	18313730	critical splice donor site	probably null
R7084:Cftr	UTSW	6	18226138	missense	probably benign	0.17
R7105:Cftr	UTSW	6	18318972	missense	probably damaging	1.00
R7320:Cftr	UTSW	6	18319013	missense	probably damaging	0.97
R7359:Cftr	UTSW	6	18221624	missense	probably benign	0.00
R7466:Cftr	UTSW	6	18227973	missense	probably benign
R7502:Cftr	UTSW	6	18214296	missense	probably damaging	1.00
R7748:Cftr	UTSW	6	18277889	critical splice donor site	probably null
R7808:Cftr	UTSW	6	18204205	missense	probably benign
R7817:Cftr	UTSW	6	18267968	missense	probably damaging	0.97
R7927:Cftr	UTSW	6	18267971	missense	possibly damaging	0.81
R7968:Cftr	UTSW	6	18226049	missense	probably benign	0.00
R7995:Cftr	UTSW	6	18214156	missense	probably damaging	1.00
R8171:Cftr	UTSW	6	18258288	missense	probably damaging	1.00
R8210:Cftr	UTSW	6	18220697	missense	probably damaging	1.00
R8548:Cftr	UTSW	6	18273699	missense	possibly damaging	0.87
R8712:Cftr	UTSW	6	18274697	missense	probably damaging	0.99
R8737:Cftr	UTSW	6	18319729	missense	probably damaging	1.00
R8926:Cftr	UTSW	6	18268004	missense	possibly damaging	0.83
R8979:Cftr	UTSW	6	18227948	missense	probably benign	0.10
R8996:Cftr	UTSW	6	18255946	nonsense	probably null
R9087:Cftr	UTSW	6	18214181	missense	possibly damaging	0.91
R9115:Cftr	UTSW	6	18235311	missense	probably damaging	1.00
R9406:Cftr	UTSW	6	18299867	missense	probably benign	0.00
R9689:Cftr	UTSW	6	18313650	missense	probably damaging	0.99
R9700:Cftr	UTSW	6	18268360	missense	probably damaging	1.00
R9747:Cftr	UTSW	6	18285637	missense	possibly damaging	0.52

Predicted Primers

PCR Primer
(F):5'- TCAGTGAGAAGCCCACACCATAGAT -3'
(R):5'- GCATTTTGACTCAGAAATCCAGCACC -3'

Sequencing Primer
(F):5'- CACACCATAGATGCTTATCGTG -3'
(R):5'- CCCATATAGATTTCCAACATTGGC -3'

Posted On

2013-04-11