Incidental Mutation 'R0134:Olfr307'
ID21822
Institutional Source Beutler Lab
Gene Symbol Olfr307
Ensembl Gene ENSMUSG00000055610
Gene Nameolfactory receptor 307
SynonymsMOR219-1, GA_x6K02T2NHDJ-9772012-9772953
MMRRC Submission 038419-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R0134 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location86332176-86337586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86335595 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 267 (I267T)
Ref Sequence ENSEMBL: ENSMUSP00000149779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069279] [ENSMUST00000213705] [ENSMUST00000217494]
Predicted Effect probably benign
Transcript: ENSMUST00000069279
AA Change: I267T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000063538
Gene: ENSMUSG00000055610
AA Change: I267T

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Pfam:7tm_4 29 306 1.6e-42 PFAM
Pfam:7tm_1 39 288 9.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213705
AA Change: I267T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000217494
AA Change: I267T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
1110059E24Rik T C 19: 21,598,201 probably benign Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cd59b G A 2: 104,078,941 probably null Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
Exoc4 A G 6: 33,971,946 D908G possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hes1 T C 16: 30,067,250 V224A probably damaging Het
Hps1 G T 19: 42,766,180 Q277K probably damaging Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Pdgfra A G 5: 75,166,511 D123G probably damaging Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Smyd1 G T 6: 71,216,765 T392N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp518b A G 5: 38,674,659 M1T probably null Het
Other mutations in Olfr307
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Olfr307 APN 7 86336061 missense probably benign 0.00
IGL02419:Olfr307 APN 7 86335662 missense probably damaging 0.98
IGL02519:Olfr307 APN 7 86335581 missense probably benign 0.01
IGL02750:Olfr307 APN 7 86335544 missense probably damaging 1.00
R0123:Olfr307 UTSW 7 86335595 missense probably benign 0.02
R0225:Olfr307 UTSW 7 86335595 missense probably benign 0.02
R1025:Olfr307 UTSW 7 86335905 missense probably benign 0.09
R1511:Olfr307 UTSW 7 86336345 missense possibly damaging 0.49
R1674:Olfr307 UTSW 7 86335557 missense probably damaging 1.00
R2011:Olfr307 UTSW 7 86335747 nonsense probably null
R4588:Olfr307 UTSW 7 86335644 missense probably benign 0.00
R5637:Olfr307 UTSW 7 86335604 missense probably benign 0.00
R6163:Olfr307 UTSW 7 86336384 missense possibly damaging 0.84
R6407:Olfr307 UTSW 7 86336069 missense possibly damaging 0.90
R7342:Olfr307 UTSW 7 86336087 missense probably benign 0.00
R8066:Olfr307 UTSW 7 86335806 missense probably benign 0.00
R8155:Olfr307 UTSW 7 86336178 missense probably damaging 1.00
R8158:Olfr307 UTSW 7 86335677 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCACCGCTCTTCTGATGCAATG -3'
(R):5'- TCCTGCTCTGAAACACTTGTGGC -3'

Sequencing Primer
(F):5'- GGTAAATCTCCAGAATGCACTG -3'
(R):5'- GCCATTTACTCATGTCTTGGAATTG -3'
Posted On2013-04-12