Incidental Mutation 'R0137:Mtor'
ID22009
Institutional Source Beutler Lab
Gene Symbol Mtor
Ensembl Gene ENSMUSG00000028991
Gene Namemechanistic target of rapamycin kinase
SynonymsRAPT1, FKBP-rapamycin-associated protein FRAP, RAFT1, flat, Frap1, 2610315D21Rik
MMRRC Submission 038422-MU
Accession Numbers

Ncbi RefSeq: NM_020009.2; MGI:1928394

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0137 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location148448611-148557683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148470624 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 901 (V901A)
Ref Sequence ENSEMBL: ENSMUSP00000099510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103221]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103221
AA Change: V901A

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: V901A

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 179 191 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
low complexity region 774 790 N/A INTRINSIC
DUF3385 854 1024 1.51e-93 SMART
low complexity region 1279 1300 N/A INTRINSIC
Pfam:FAT 1513 1908 2.3e-134 PFAM
Rapamycin_bind 2015 2114 7.94e-61 SMART
PI3Kc 2183 2484 8.84e-121 SMART
FATC 2517 2549 2.11e-15 SMART
Meta Mutation Damage Score 0.0979 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency 95% (94/99)
MGI Phenotype Strain: 3529989; 4820819; 3512186; 5425404; 3052669
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A G 19: 8,740,857 probably benign Het
4931406P16Rik A T 7: 34,239,219 W246R probably damaging Het
6430548M08Rik A T 8: 120,151,376 H190L possibly damaging Het
Adap1 A G 5: 139,293,221 probably benign Het
Adgra3 C T 5: 49,963,840 probably benign Het
Adgre5 A T 8: 83,724,898 V527E probably damaging Het
Anapc5 A T 5: 122,800,632 Y360N probably damaging Het
Angptl6 C A 9: 20,878,387 A70S probably benign Het
Ankdd1a C A 9: 65,510,328 K137N probably null Het
Ccdc170 T C 10: 4,546,950 probably benign Het
Ccdc51 A G 9: 109,091,630 E195G probably damaging Het
Cdc37 A T 9: 21,142,130 C204S possibly damaging Het
Cfap36 T C 11: 29,222,431 probably benign Het
Col6a2 C A 10: 76,596,425 G965C probably damaging Het
Csn1s2a G A 5: 87,778,967 S53N possibly damaging Het
Dab2ip T C 2: 35,692,376 probably null Het
Dhx58 A G 11: 100,696,997 V578A probably damaging Het
Diaph1 G T 18: 37,891,849 Q520K unknown Het
Eefsec C A 6: 88,297,649 K444N probably benign Het
Eftud2 A T 11: 102,868,617 H153Q possibly damaging Het
Eif5b T G 1: 38,019,243 S209A probably benign Het
Exosc2 T A 2: 31,672,485 Y46N probably damaging Het
F2 C T 2: 91,625,730 G562D probably damaging Het
Fgf23 G A 6: 127,080,165 G148D probably damaging Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Fstl5 G A 3: 76,707,479 G179R probably damaging Het
Gart T A 16: 91,625,394 Q745L probably benign Het
Gmeb1 T A 4: 132,232,108 M212L probably benign Het
Gpaa1 T C 15: 76,334,781 Y548H probably damaging Het
Gpatch1 T C 7: 35,287,242 E763G probably damaging Het
Grm8 T A 6: 27,762,390 I279F probably damaging Het
Hcls1 T A 16: 36,951,174 H147Q probably damaging Het
Hpcal1 A C 12: 17,786,388 D73A probably damaging Het
Il22ra1 T C 4: 135,751,006 S463P probably benign Het
Itgbl1 G A 14: 123,840,686 probably null Het
Izumo3 G T 4: 92,147,200 probably benign Het
Kcna5 A T 6: 126,533,383 L594Q probably damaging Het
Kif13a A T 13: 46,764,603 D409E probably benign Het
Kif9 A T 9: 110,485,038 I39F probably damaging Het
Klri2 C T 6: 129,732,208 R227H possibly damaging Het
Lamc3 G A 2: 31,908,616 G445S probably damaging Het
Lctl A G 9: 64,117,698 probably benign Het
Lrp4 T C 2: 91,494,982 L1384P probably damaging Het
Mcm9 G A 10: 53,563,430 S549L possibly damaging Het
Ms4a15 G A 19: 10,979,333 probably benign Het
Nckap1l A T 15: 103,481,964 I721F probably benign Het
Nemp2 T C 1: 52,645,429 V298A probably benign Het
Npc1l1 T A 11: 6,228,148 K421* probably null Het
Npr1 C T 3: 90,455,937 V879M probably damaging Het
Olfr1368 A G 13: 21,142,166 V297A possibly damaging Het
Olfr638 A G 7: 104,003,502 T82A probably benign Het
Osgin1 A T 8: 119,442,480 I39F possibly damaging Het
Phip G C 9: 82,927,191 probably null Het
Pkdrej G T 15: 85,821,567 P56Q possibly damaging Het
Plcxd2 A G 16: 45,980,526 Y112H probably damaging Het
Plekha1 C T 7: 130,897,446 T155M probably damaging Het
Prkdc T C 16: 15,740,332 probably null Het
Prss1 A G 6: 41,462,561 H76R probably damaging Het
Psg23 T C 7: 18,614,633 D83G probably benign Het
Ptprd T A 4: 76,136,903 Q196L probably benign Het
Ranbp3l A T 15: 9,062,987 H292L probably damaging Het
Ranbp6 T C 19: 29,809,697 E1085G probably benign Het
Rccd1 A G 7: 80,320,578 V97A possibly damaging Het
Rchy1 T C 5: 91,957,599 S48G probably benign Het
Rnmt G A 18: 68,313,700 M265I probably benign Het
Robo3 A T 9: 37,425,344 M376K probably benign Het
Rrp12 T C 19: 41,873,850 D898G probably benign Het
Scg3 A T 9: 75,663,180 probably benign Het
Sec31b A T 19: 44,534,382 M57K probably damaging Het
Slc17a6 A C 7: 51,666,144 I387L probably benign Het
Speer4a T A 5: 26,035,984 Q170L possibly damaging Het
Srsf9 A G 5: 115,332,201 D146G possibly damaging Het
Ss18 A G 18: 14,655,143 M90T probably damaging Het
Syna A T 5: 134,559,460 F212I possibly damaging Het
Thsd1 A G 8: 22,243,039 H34R probably damaging Het
Tmem143 T C 7: 45,897,662 I84T probably benign Het
Trim50 T C 5: 135,366,633 V281A probably damaging Het
Trp53i11 C A 2: 93,199,351 probably benign Het
Ttc25 A G 11: 100,563,568 E393G probably damaging Het
Ttll4 C T 1: 74,679,692 T234I possibly damaging Het
Ttyh1 A T 7: 4,124,720 I136F possibly damaging Het
Ube2f T C 1: 91,262,254 probably benign Het
Vcl T A 14: 20,987,015 L227* probably null Het
Vmn1r222 A C 13: 23,232,804 C80G probably damaging Het
Vps13b G T 15: 35,926,219 A3889S probably benign Het
Vps8 T C 16: 21,504,386 probably benign Het
Zbtb44 A G 9: 31,066,710 Y422C probably damaging Het
Zfp180 A G 7: 24,105,733 S526G possibly damaging Het
Zfp518a A C 19: 40,915,866 E1413A probably damaging Het
Zfp629 T A 7: 127,611,686 Y317F probably damaging Het
Zfp804b T C 5: 6,770,534 E843G probably benign Het
Other mutations in Mtor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Mtor APN 4 148453037 missense probably benign 0.06
IGL01447:Mtor APN 4 148530757 missense possibly damaging 0.62
IGL01551:Mtor APN 4 148472037 missense probably damaging 0.99
IGL01661:Mtor APN 4 148514851 missense possibly damaging 0.61
IGL01675:Mtor APN 4 148484654 missense probably benign 0.00
IGL01743:Mtor APN 4 148530613 splice site probably benign
IGL02015:Mtor APN 4 148540113 nonsense probably null
IGL02084:Mtor APN 4 148470680 missense probably damaging 0.98
IGL02095:Mtor APN 4 148544541 missense probably damaging 1.00
IGL02129:Mtor APN 4 148549845 missense possibly damaging 0.91
IGL02260:Mtor APN 4 148538301 missense probably damaging 1.00
IGL02329:Mtor APN 4 148534939 missense probably benign 0.16
IGL02440:Mtor APN 4 148546429 missense probably benign 0.24
IGL02440:Mtor APN 4 148491647 missense probably benign 0.04
IGL02449:Mtor APN 4 148533921 missense possibly damaging 0.65
IGL02479:Mtor APN 4 148470584 missense probably damaging 1.00
IGL02904:Mtor APN 4 148452394 missense possibly damaging 0.55
IGL02904:Mtor APN 4 148491612 splice site probably benign
IGL02931:Mtor APN 4 148464964 missense probably benign 0.22
IGL03048:Mtor APN 4 148546390 splice site probably benign
IGL03133:Mtor APN 4 148484319 missense probably benign 0.01
IGL03142:Mtor APN 4 148453899 missense probably benign 0.00
Dynamo UTSW 4 148462910 missense probably benign 0.00
engine UTSW 4 148556855 unclassified probably null
motor UTSW 4 148491360 missense possibly damaging 0.76
PIT4519001:Mtor UTSW 4 148524500 missense probably damaging 1.00
R0045:Mtor UTSW 4 148464949 missense probably benign 0.42
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0103:Mtor UTSW 4 148533902 missense probably benign 0.05
R0112:Mtor UTSW 4 148480923 missense probably damaging 1.00
R0184:Mtor UTSW 4 148464971 missense probably benign 0.05
R0208:Mtor UTSW 4 148464975 missense probably benign 0.43
R0329:Mtor UTSW 4 148484380 missense probably benign
R0330:Mtor UTSW 4 148484380 missense probably benign
R0365:Mtor UTSW 4 148486050 missense probably benign 0.01
R0537:Mtor UTSW 4 148538360 missense probably damaging 1.00
R0542:Mtor UTSW 4 148540450 missense probably benign 0.02
R0556:Mtor UTSW 4 148469380 missense possibly damaging 0.88
R0613:Mtor UTSW 4 148526046 missense possibly damaging 0.95
R0646:Mtor UTSW 4 148484354 nonsense probably null
R0710:Mtor UTSW 4 148464391 missense possibly damaging 0.73
R0791:Mtor UTSW 4 148462910 missense probably benign 0.00
R0792:Mtor UTSW 4 148462910 missense probably benign 0.00
R0866:Mtor UTSW 4 148486056 missense probably benign 0.04
R0973:Mtor UTSW 4 148550188 missense probably damaging 1.00
R1027:Mtor UTSW 4 148539999 missense probably benign 0.03
R1028:Mtor UTSW 4 148538830 missense possibly damaging 0.88
R1289:Mtor UTSW 4 148470307 missense probably benign 0.10
R1416:Mtor UTSW 4 148491414 nonsense probably null
R1465:Mtor UTSW 4 148525993 splice site probably benign
R1506:Mtor UTSW 4 148536505 splice site probably benign
R1624:Mtor UTSW 4 148547676 missense probably damaging 1.00
R1695:Mtor UTSW 4 148538907 missense probably benign 0.08
R1771:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R1800:Mtor UTSW 4 148462892 missense probably benign 0.00
R1855:Mtor UTSW 4 148553089 missense probably benign 0.02
R1857:Mtor UTSW 4 148480879 missense probably damaging 1.00
R1867:Mtor UTSW 4 148454632 missense probably damaging 0.97
R1954:Mtor UTSW 4 148468273 missense probably damaging 1.00
R2054:Mtor UTSW 4 148462852 missense probably benign 0.05
R2054:Mtor UTSW 4 148466025 missense probably benign 0.00
R2099:Mtor UTSW 4 148550192 nonsense probably null
R2148:Mtor UTSW 4 148456012 missense possibly damaging 0.56
R2214:Mtor UTSW 4 148538870 missense probably benign 0.39
R2281:Mtor UTSW 4 148489555 missense probably benign 0.02
R2512:Mtor UTSW 4 148530491 missense possibly damaging 0.95
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2873:Mtor UTSW 4 148540030 missense probably benign 0.00
R4032:Mtor UTSW 4 148536752 missense probably benign 0.03
R4073:Mtor UTSW 4 148549375 missense probably damaging 0.99
R4273:Mtor UTSW 4 148550152 missense probably benign 0.21
R4611:Mtor UTSW 4 148486119 missense probably benign 0.03
R4858:Mtor UTSW 4 148454816 makesense probably null
R4942:Mtor UTSW 4 148472142 missense probably benign 0.03
R4967:Mtor UTSW 4 148491360 missense possibly damaging 0.76
R4995:Mtor UTSW 4 148525752 missense probably damaging 1.00
R5054:Mtor UTSW 4 148556855 unclassified probably null
R5215:Mtor UTSW 4 148453983 missense probably benign
R5249:Mtor UTSW 4 148463732 missense probably damaging 1.00
R5289:Mtor UTSW 4 148466092 missense possibly damaging 0.88
R5365:Mtor UTSW 4 148550130 missense probably damaging 0.99
R5498:Mtor UTSW 4 148540364 missense possibly damaging 0.71
R5514:Mtor UTSW 4 148546444 missense probably damaging 1.00
R5540:Mtor UTSW 4 148454708 missense probably benign 0.01
R5600:Mtor UTSW 4 148491470 missense probably damaging 1.00
R5615:Mtor UTSW 4 148538276 missense possibly damaging 0.95
R5632:Mtor UTSW 4 148469006 missense possibly damaging 0.94
R5641:Mtor UTSW 4 148546425 missense probably damaging 0.98
R5834:Mtor UTSW 4 148536536 missense possibly damaging 0.95
R5984:Mtor UTSW 4 148538827 missense probably benign 0.02
R6056:Mtor UTSW 4 148537435 missense probably benign 0.00
R6225:Mtor UTSW 4 148521337 missense probably benign 0.04
R6262:Mtor UTSW 4 148526095 missense possibly damaging 0.46
R6335:Mtor UTSW 4 148465927 missense probably damaging 1.00
R6479:Mtor UTSW 4 148551000 missense probably benign 0.16
R6543:Mtor UTSW 4 148545596 missense probably damaging 1.00
R6711:Mtor UTSW 4 148452367 missense possibly damaging 0.49
R6715:Mtor UTSW 4 148538547 missense probably benign 0.00
R6744:Mtor UTSW 4 148458655 missense probably benign 0.01
R6748:Mtor UTSW 4 148550184 missense probably damaging 1.00
R6762:Mtor UTSW 4 148538481 missense possibly damaging 0.47
R6836:Mtor UTSW 4 148489498 missense possibly damaging 0.94
R6948:Mtor UTSW 4 148536752 missense probably benign 0.12
R6979:Mtor UTSW 4 148524473 missense possibly damaging 0.60
R6992:Mtor UTSW 4 148464475 missense probably benign
R7271:Mtor UTSW 4 148546485 missense possibly damaging 0.70
R7423:Mtor UTSW 4 148556344 missense possibly damaging 0.77
R7434:Mtor UTSW 4 148464959 missense probably benign 0.39
R7619:Mtor UTSW 4 148462795 missense probably damaging 0.98
R7634:Mtor UTSW 4 148452350 missense possibly damaging 0.53
R7697:Mtor UTSW 4 148540308 nonsense probably null
R7737:Mtor UTSW 4 148538738 missense possibly damaging 0.95
R7791:Mtor UTSW 4 148462940 missense probably benign 0.00
R7858:Mtor UTSW 4 148454646 missense probably damaging 1.00
R7941:Mtor UTSW 4 148454646 missense probably damaging 1.00
X0025:Mtor UTSW 4 148530714 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGGACATGATGGCAGTAACCCAGC -3'
(R):5'- GCAGGGACTACAGGCTCTTCATTC -3'

Sequencing Primer
(F):5'- TCTCTGCTCTGTTGATGAGATG -3'
(R):5'- TCACAAGTTGCCAAGAGATTCAG -3'
Posted On2013-04-12