Mutagenetix > Incidental Mutation

Incidental Mutation 'R2214:Mtor'

241006

Institutional Source

Beutler Lab

Gene Symbol

Mtor

Ensembl Gene

ENSMUSG00000028991

Gene Name

mechanistic target of rapamycin kinase

Synonyms

flat, 2610315D21Rik, RAPT1, RAFT1, mechanistic target of rapamycin (serine/threonine kinase), FKBP-rapamycin-associated protein FRAP, Frap1

MMRRC Submission

040216-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2214 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

148533068-148642140 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 148623327 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 2059 (E2059G)

Ref Sequence

ENSEMBL: ENSMUSP00000099510 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103221]

AlphaFold

Q9JLN9

Predicted Effect

probably benign
Transcript: ENSMUST00000103221
AA Change: E2059G

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: E2059G

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	179	191	N/A	INTRINSIC
low complexity region	277	288	N/A	INTRINSIC
low complexity region	774	790	N/A	INTRINSIC
DUF3385	854	1024	1.51e-93	SMART
low complexity region	1279	1300	N/A	INTRINSIC
Pfam:FAT	1513	1908	2.3e-134	PFAM
Rapamycin_bind	2015	2114	7.94e-61	SMART
PI3Kc	2183	2484	8.84e-121	SMART
FATC	2517	2549	2.11e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158456

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap2	T	C	16: 30,926,946 (GRCm39)	Y516C	probably benign	Het
Adam22	C	T	5: 8,186,805 (GRCm39)		probably null	Het
Akap8l	T	C	17: 32,557,799 (GRCm39)		probably null	Het
Casr	T	C	16: 36,336,120 (GRCm39)	Y63C	probably damaging	Het
Ccdc178	T	C	18: 22,048,047 (GRCm39)	D781G	possibly damaging	Het
Col9a1	C	A	1: 24,247,283 (GRCm39)	P168Q	probably damaging	Het
Dnm2	T	C	9: 21,397,019 (GRCm39)		probably null	Het
Dst	C	T	1: 34,310,482 (GRCm39)	T6325M	probably damaging	Het
Ercc4	C	A	16: 12,927,888 (GRCm39)	D19E	probably damaging	Het
Gm1110	C	A	9: 26,813,786 (GRCm39)	V198L	probably benign	Het
Gm8674	T	A	13: 50,055,396 (GRCm39)		noncoding transcript	Het
Grm7	A	T	6: 111,335,958 (GRCm39)	I790F	probably damaging	Het
Habp2	A	G	19: 56,306,249 (GRCm39)	D445G	possibly damaging	Het
Kat7	G	A	11: 95,166,631 (GRCm39)	T517I	probably damaging	Het
Kbtbd11	T	A	8: 15,079,178 (GRCm39)	D592E	possibly damaging	Het
Lgals8	T	A	13: 12,469,713 (GRCm39)	Q82L	probably benign	Het
Lmtk3	A	G	7: 45,444,277 (GRCm39)		probably benign	Het
Map2	A	T	1: 66,459,345 (GRCm39)	D1530V	probably damaging	Het
Map2k6	G	A	11: 110,387,167 (GRCm39)	V180I	probably damaging	Het
Map3k5	T	A	10: 19,902,035 (GRCm39)		probably null	Het
Myh10	A	G	11: 68,673,953 (GRCm39)	D660G	probably damaging	Het
Myo16	T	A	8: 10,488,803 (GRCm39)	V658E	probably damaging	Het
Nckap5	A	T	1: 125,953,487 (GRCm39)	S1090T	possibly damaging	Het
Nhlrc3	T	C	3: 53,363,875 (GRCm39)	H217R	probably damaging	Het
Ntrk3	T	A	7: 78,166,520 (GRCm39)	I118F	probably damaging	Het
Or14a259	T	A	7: 86,013,414 (GRCm39)	I44F	probably benign	Het
Or1e29	A	T	11: 73,667,655 (GRCm39)	L166*	probably null	Het
Or4p20	C	T	2: 88,253,461 (GRCm39)	V303M	probably benign	Het
Paxip1	T	C	5: 27,947,499 (GRCm39)	Y1053C	probably damaging	Het
Pfkfb4	T	A	9: 108,834,677 (GRCm39)	F117I	probably benign	Het
Pp2d1	T	C	17: 53,822,424 (GRCm39)	Y214C	probably benign	Het
Prr7	C	A	13: 55,620,613 (GRCm39)	S207*	probably null	Het
Ptprh	T	A	7: 4,555,921 (GRCm39)	Q715L	possibly damaging	Het
Rasgrp1	A	T	2: 117,115,646 (GRCm39)	D647E	probably damaging	Het
Rnf20	T	A	4: 49,648,344 (GRCm39)	M384K	possibly damaging	Het
Rps6kb1	A	T	11: 86,424,896 (GRCm39)	C37S	possibly damaging	Het
Serpinb9f	C	A	13: 33,518,592 (GRCm39)	T364K	probably benign	Het
Sorbs1	C	T	19: 40,285,075 (GRCm39)	A641T	probably damaging	Het
Srrm2	T	C	17: 24,035,719 (GRCm39)		probably benign	Het
Stag3	C	T	5: 138,299,528 (GRCm39)	S849L	possibly damaging	Het
Syt15	A	T	14: 33,944,989 (GRCm39)	S179C	probably damaging	Het
Tapbp	T	C	17: 34,139,300 (GRCm39)	F90L	possibly damaging	Het
Timm23	A	T	14: 31,920,944 (GRCm39)	D49E	probably damaging	Het
Tmcc1	C	CAT	6: 116,019,831 (GRCm39)		probably null	Het
Tmem174	A	C	13: 98,773,757 (GRCm39)	S24R	possibly damaging	Het
Tmem63a	A	G	1: 180,788,679 (GRCm39)	S339G	probably benign	Het
Tsc22d2	A	G	3: 58,323,627 (GRCm39)	Y173C	probably damaging	Het
Ubap2	A	G	4: 41,199,714 (GRCm39)		probably null	Het
Upp1	T	A	11: 9,086,033 (GRCm39)	V290E	probably benign	Het
Uqcc4	T	C	17: 25,403,699 (GRCm39)	V13A	probably benign	Het
Usp17lb	A	T	7: 104,490,639 (GRCm39)	M96K	probably benign	Het
Wdr20rt	A	G	12: 65,274,187 (GRCm39)	E449G	probably damaging	Het
Zkscan8	A	T	13: 21,705,082 (GRCm39)	S286T	probably benign	Het

Other mutations in Mtor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Mtor	APN	4	148,537,494 (GRCm39)	missense	probably benign	0.06
IGL01447:Mtor	APN	4	148,615,214 (GRCm39)	missense	possibly damaging	0.62
IGL01551:Mtor	APN	4	148,556,494 (GRCm39)	missense	probably damaging	0.99
IGL01661:Mtor	APN	4	148,599,308 (GRCm39)	missense	possibly damaging	0.61
IGL01675:Mtor	APN	4	148,569,111 (GRCm39)	missense	probably benign	0.00
IGL01743:Mtor	APN	4	148,615,070 (GRCm39)	splice site	probably benign
IGL02015:Mtor	APN	4	148,624,570 (GRCm39)	nonsense	probably null
IGL02084:Mtor	APN	4	148,555,137 (GRCm39)	missense	probably damaging	0.98
IGL02095:Mtor	APN	4	148,628,998 (GRCm39)	missense	probably damaging	1.00
IGL02129:Mtor	APN	4	148,634,302 (GRCm39)	missense	possibly damaging	0.91
IGL02260:Mtor	APN	4	148,622,758 (GRCm39)	missense	probably damaging	1.00
IGL02329:Mtor	APN	4	148,619,396 (GRCm39)	missense	probably benign	0.16
IGL02440:Mtor	APN	4	148,576,104 (GRCm39)	missense	probably benign	0.04
IGL02440:Mtor	APN	4	148,630,886 (GRCm39)	missense	probably benign	0.24
IGL02449:Mtor	APN	4	148,618,378 (GRCm39)	missense	possibly damaging	0.65
IGL02479:Mtor	APN	4	148,555,041 (GRCm39)	missense	probably damaging	1.00
IGL02904:Mtor	APN	4	148,576,069 (GRCm39)	splice site	probably benign
IGL02904:Mtor	APN	4	148,536,851 (GRCm39)	missense	possibly damaging	0.55
IGL02931:Mtor	APN	4	148,549,421 (GRCm39)	missense	probably benign	0.22
IGL03048:Mtor	APN	4	148,630,847 (GRCm39)	splice site	probably benign
IGL03133:Mtor	APN	4	148,568,776 (GRCm39)	missense	probably benign	0.01
IGL03142:Mtor	APN	4	148,538,356 (GRCm39)	missense	probably benign	0.00
Brushes	UTSW	4	148,548,205 (GRCm39)	missense	probably benign	0.00
Dynamo	UTSW	4	148,547,367 (GRCm39)	missense	probably benign	0.00
engine	UTSW	4	148,641,312 (GRCm39)	splice site	probably null
Erg	UTSW	4	148,630,053 (GRCm39)	missense	probably damaging	1.00
Lindor	UTSW	4	148,539,103 (GRCm39)	missense	probably damaging	1.00
motor	UTSW	4	148,575,817 (GRCm39)	missense	possibly damaging	0.76
R4858_Mtor_211	UTSW	4	148,539,273 (GRCm39)	makesense	probably null
Vigor	UTSW	4	148,623,356 (GRCm39)	missense	probably damaging	1.00
Vim	UTSW	4	148,610,260 (GRCm39)	critical splice donor site	probably null
PIT4519001:Mtor	UTSW	4	148,608,957 (GRCm39)	missense	probably damaging	1.00
R0045:Mtor	UTSW	4	148,549,406 (GRCm39)	missense	probably benign	0.42
R0048:Mtor	UTSW	4	148,623,338 (GRCm39)	nonsense	probably null
R0048:Mtor	UTSW	4	148,623,338 (GRCm39)	nonsense	probably null
R0103:Mtor	UTSW	4	148,618,359 (GRCm39)	missense	probably benign	0.05
R0112:Mtor	UTSW	4	148,565,380 (GRCm39)	missense	probably damaging	1.00
R0137:Mtor	UTSW	4	148,555,081 (GRCm39)	missense	possibly damaging	0.78
R0184:Mtor	UTSW	4	148,549,428 (GRCm39)	missense	probably benign	0.05
R0208:Mtor	UTSW	4	148,549,432 (GRCm39)	missense	probably benign	0.43
R0329:Mtor	UTSW	4	148,568,837 (GRCm39)	missense	probably benign
R0330:Mtor	UTSW	4	148,568,837 (GRCm39)	missense	probably benign
R0365:Mtor	UTSW	4	148,570,507 (GRCm39)	missense	probably benign	0.01
R0537:Mtor	UTSW	4	148,622,817 (GRCm39)	missense	probably damaging	1.00
R0542:Mtor	UTSW	4	148,624,907 (GRCm39)	missense	probably benign	0.02
R0556:Mtor	UTSW	4	148,553,837 (GRCm39)	missense	possibly damaging	0.88
R0613:Mtor	UTSW	4	148,610,503 (GRCm39)	missense	possibly damaging	0.95
R0646:Mtor	UTSW	4	148,568,811 (GRCm39)	nonsense	probably null
R0710:Mtor	UTSW	4	148,548,848 (GRCm39)	missense	possibly damaging	0.73
R0791:Mtor	UTSW	4	148,547,367 (GRCm39)	missense	probably benign	0.00
R0792:Mtor	UTSW	4	148,547,367 (GRCm39)	missense	probably benign	0.00
R0866:Mtor	UTSW	4	148,570,513 (GRCm39)	missense	probably benign	0.04
R0973:Mtor	UTSW	4	148,634,645 (GRCm39)	missense	probably damaging	1.00
R1027:Mtor	UTSW	4	148,624,456 (GRCm39)	missense	probably benign	0.03
R1028:Mtor	UTSW	4	148,623,287 (GRCm39)	missense	possibly damaging	0.88
R1289:Mtor	UTSW	4	148,554,764 (GRCm39)	missense	probably benign	0.10
R1416:Mtor	UTSW	4	148,575,871 (GRCm39)	nonsense	probably null
R1465:Mtor	UTSW	4	148,610,450 (GRCm39)	splice site	probably benign
R1506:Mtor	UTSW	4	148,620,962 (GRCm39)	splice site	probably benign
R1624:Mtor	UTSW	4	148,632,133 (GRCm39)	missense	probably damaging	1.00
R1695:Mtor	UTSW	4	148,623,364 (GRCm39)	missense	probably benign	0.08
R1771:Mtor	UTSW	4	148,555,081 (GRCm39)	missense	possibly damaging	0.78
R1800:Mtor	UTSW	4	148,547,349 (GRCm39)	missense	probably benign	0.00
R1855:Mtor	UTSW	4	148,637,546 (GRCm39)	missense	probably benign	0.02
R1857:Mtor	UTSW	4	148,565,336 (GRCm39)	missense	probably damaging	1.00
R1867:Mtor	UTSW	4	148,539,089 (GRCm39)	missense	probably damaging	0.97
R1954:Mtor	UTSW	4	148,552,730 (GRCm39)	missense	probably damaging	1.00
R2054:Mtor	UTSW	4	148,550,482 (GRCm39)	missense	probably benign	0.00
R2054:Mtor	UTSW	4	148,547,309 (GRCm39)	missense	probably benign	0.05
R2099:Mtor	UTSW	4	148,634,649 (GRCm39)	nonsense	probably null
R2148:Mtor	UTSW	4	148,540,469 (GRCm39)	missense	possibly damaging	0.56
R2281:Mtor	UTSW	4	148,574,012 (GRCm39)	missense	probably benign	0.02
R2512:Mtor	UTSW	4	148,614,948 (GRCm39)	missense	possibly damaging	0.95
R2870:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2870:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2873:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R4032:Mtor	UTSW	4	148,621,209 (GRCm39)	missense	probably benign	0.03
R4073:Mtor	UTSW	4	148,633,832 (GRCm39)	missense	probably damaging	0.99
R4273:Mtor	UTSW	4	148,634,609 (GRCm39)	missense	probably benign	0.21
R4611:Mtor	UTSW	4	148,570,576 (GRCm39)	missense	probably benign	0.03
R4858:Mtor	UTSW	4	148,539,273 (GRCm39)	makesense	probably null
R4942:Mtor	UTSW	4	148,556,599 (GRCm39)	missense	probably benign	0.03
R4967:Mtor	UTSW	4	148,575,817 (GRCm39)	missense	possibly damaging	0.76
R4995:Mtor	UTSW	4	148,610,209 (GRCm39)	missense	probably damaging	1.00
R5054:Mtor	UTSW	4	148,641,312 (GRCm39)	splice site	probably null
R5215:Mtor	UTSW	4	148,538,440 (GRCm39)	missense	probably benign
R5249:Mtor	UTSW	4	148,548,189 (GRCm39)	missense	probably damaging	1.00
R5289:Mtor	UTSW	4	148,550,549 (GRCm39)	missense	possibly damaging	0.88
R5365:Mtor	UTSW	4	148,634,587 (GRCm39)	missense	probably damaging	0.99
R5498:Mtor	UTSW	4	148,624,821 (GRCm39)	missense	possibly damaging	0.71
R5514:Mtor	UTSW	4	148,630,901 (GRCm39)	missense	probably damaging	1.00
R5540:Mtor	UTSW	4	148,539,165 (GRCm39)	missense	probably benign	0.01
R5600:Mtor	UTSW	4	148,575,927 (GRCm39)	missense	probably damaging	1.00
R5615:Mtor	UTSW	4	148,622,733 (GRCm39)	missense	possibly damaging	0.95
R5632:Mtor	UTSW	4	148,553,463 (GRCm39)	missense	possibly damaging	0.94
R5641:Mtor	UTSW	4	148,630,882 (GRCm39)	missense	probably damaging	0.98
R5834:Mtor	UTSW	4	148,620,993 (GRCm39)	missense	possibly damaging	0.95
R5984:Mtor	UTSW	4	148,623,284 (GRCm39)	missense	probably benign	0.02
R6056:Mtor	UTSW	4	148,621,892 (GRCm39)	missense	probably benign	0.00
R6225:Mtor	UTSW	4	148,605,794 (GRCm39)	missense	probably benign	0.04
R6262:Mtor	UTSW	4	148,610,552 (GRCm39)	missense	possibly damaging	0.46
R6335:Mtor	UTSW	4	148,550,384 (GRCm39)	missense	probably damaging	1.00
R6479:Mtor	UTSW	4	148,635,457 (GRCm39)	missense	probably benign	0.16
R6543:Mtor	UTSW	4	148,630,053 (GRCm39)	missense	probably damaging	1.00
R6711:Mtor	UTSW	4	148,536,824 (GRCm39)	missense	possibly damaging	0.49
R6715:Mtor	UTSW	4	148,623,004 (GRCm39)	missense	probably benign	0.00
R6744:Mtor	UTSW	4	148,543,112 (GRCm39)	missense	probably benign	0.01
R6748:Mtor	UTSW	4	148,634,641 (GRCm39)	missense	probably damaging	1.00
R6762:Mtor	UTSW	4	148,622,938 (GRCm39)	missense	possibly damaging	0.47
R6836:Mtor	UTSW	4	148,573,955 (GRCm39)	missense	possibly damaging	0.94
R6948:Mtor	UTSW	4	148,621,209 (GRCm39)	missense	probably benign	0.12
R6979:Mtor	UTSW	4	148,608,930 (GRCm39)	missense	possibly damaging	0.60
R6992:Mtor	UTSW	4	148,548,932 (GRCm39)	missense	probably benign
R7271:Mtor	UTSW	4	148,630,942 (GRCm39)	missense	possibly damaging	0.70
R7423:Mtor	UTSW	4	148,640,801 (GRCm39)	missense	possibly damaging	0.77
R7434:Mtor	UTSW	4	148,549,416 (GRCm39)	missense	probably benign	0.39
R7619:Mtor	UTSW	4	148,547,252 (GRCm39)	missense	probably damaging	0.98
R7634:Mtor	UTSW	4	148,536,807 (GRCm39)	missense	possibly damaging	0.53
R7697:Mtor	UTSW	4	148,624,765 (GRCm39)	nonsense	probably null
R7737:Mtor	UTSW	4	148,623,195 (GRCm39)	missense	possibly damaging	0.95
R7791:Mtor	UTSW	4	148,547,397 (GRCm39)	missense	probably benign	0.00
R7858:Mtor	UTSW	4	148,539,103 (GRCm39)	missense	probably damaging	1.00
R8035:Mtor	UTSW	4	148,630,856 (GRCm39)	missense	probably benign	0.29
R8076:Mtor	UTSW	4	148,610,260 (GRCm39)	critical splice donor site	probably null
R8078:Mtor	UTSW	4	148,552,744 (GRCm39)	missense	probably benign
R8928:Mtor	UTSW	4	148,623,356 (GRCm39)	missense	probably damaging	1.00
R9040:Mtor	UTSW	4	148,548,205 (GRCm39)	missense	probably benign	0.00
R9116:Mtor	UTSW	4	148,637,198 (GRCm39)	missense	probably benign
R9284:Mtor	UTSW	4	148,543,537 (GRCm39)	missense	probably benign	0.03
R9310:Mtor	UTSW	4	148,553,834 (GRCm39)	missense	probably benign	0.03
R9374:Mtor	UTSW	4	148,599,397 (GRCm39)	missense	probably damaging	1.00
R9417:Mtor	UTSW	4	148,622,776 (GRCm39)	nonsense	probably null
R9465:Mtor	UTSW	4	148,624,839 (GRCm39)	missense	possibly damaging	0.92
R9492:Mtor	UTSW	4	148,568,801 (GRCm39)	missense	probably damaging	1.00
R9499:Mtor	UTSW	4	148,599,397 (GRCm39)	missense	probably damaging	1.00
R9516:Mtor	UTSW	4	148,569,103 (GRCm39)	missense	probably benign	0.23
R9600:Mtor	UTSW	4	148,632,092 (GRCm39)	missense	possibly damaging	0.82
R9622:Mtor	UTSW	4	148,568,169 (GRCm39)	missense	probably damaging	0.99
X0025:Mtor	UTSW	4	148,615,171 (GRCm39)	missense	probably benign	0.09
Z1176:Mtor	UTSW	4	148,634,587 (GRCm39)	missense	possibly damaging	0.69
Z1176:Mtor	UTSW	4	148,634,582 (GRCm39)	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- CAATCGTAGCTTCCTGTGGTG -3'
(R):5'- CATGAGTTCTAGGTCTACGCTG -3'

Sequencing Primer
(F):5'- CGTAGCTTCCTGTGGTGTATCTTTC -3'
(R):5'- GCATTTGTAATTCTGCACAGAGC -3'

Posted On

2014-10-15