Incidental Mutation 'R2033:Nudt18'
ID221540
Institutional Source Beutler Lab
Gene Symbol Nudt18
Ensembl Gene ENSMUSG00000045211
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 18
Synonyms
MMRRC Submission 040040-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R2033 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location70577637-70582688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 70579616 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 162 (G162V)
Ref Sequence ENSEMBL: ENSMUSP00000154258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022690] [ENSMUST00000089049] [ENSMUST00000228554] [ENSMUST00000228768]
Predicted Effect probably benign
Transcript: ENSMUST00000022690
SMART Domains Protein: ENSMUSP00000022690
Gene: ENSMUSG00000022095

DomainStartEndE-ValueType
Pfam:RAI16-like 79 477 7.7e-112 PFAM
low complexity region 516 528 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000089049
AA Change: G220V

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000086450
Gene: ENSMUSG00000045211
AA Change: G220V

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:NUDIX 44 165 2.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228554
Predicted Effect possibly damaging
Transcript: ENSMUST00000228768
AA Change: G162V

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1255 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Nudix hydrolase family. Nudix hydrolases eliminate potentially toxic nucleotide metabolites from the cell and regulate the concentrations and availability of many different nucleotide substrates, cofactors, and signaling molecules. This protein contains a Nudix hydrolase domain and hydrolyzes oxidized forms of guanosine and deoxyguanosine diphosphates. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,456,383 T172A probably benign Het
Atp6v1c1 T C 15: 38,673,966 probably null Het
Bpifc G A 10: 86,000,632 T3I possibly damaging Het
Car12 A G 9: 66,717,558 probably null Het
Ccrl2 A G 9: 111,055,870 F187L possibly damaging Het
Cep250 G A 2: 155,970,892 R544H probably damaging Het
Col4a3 T G 1: 82,718,011 probably benign Het
Cyb5r2 T C 7: 107,756,907 probably null Het
Elfn2 A G 15: 78,671,896 V817A probably damaging Het
Eln C T 5: 134,710,106 probably null Het
Eml5 T C 12: 98,791,386 E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,577,154 probably null Het
Galnt11 C T 5: 25,247,538 T16I probably damaging Het
Gars C T 6: 55,077,723 H672Y probably benign Het
Gpr155 T A 2: 73,348,182 H726L probably benign Het
Inpp1 T A 1: 52,790,173 N229I possibly damaging Het
Isg20 A C 7: 78,916,533 I77L probably damaging Het
Kit G C 5: 75,637,317 D422H possibly damaging Het
Lonp2 A G 8: 86,708,942 E602G possibly damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Myh6 A C 14: 54,963,645 L120R probably benign Het
Myo18a T A 11: 77,843,099 probably null Het
Nphs2 T C 1: 156,323,738 V249A probably damaging Het
Npsr1 A G 9: 24,313,352 K342E probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Odam A G 5: 87,892,419 D248G probably benign Het
Olfr1224-ps1 A G 2: 89,157,154 V7A probably damaging Het
Olfr147 G T 9: 38,403,373 M166I probably damaging Het
Olfr390 T C 11: 73,787,438 S167P probably benign Het
Olfr557 A G 7: 102,699,162 E308G probably benign Het
Olfr572 T C 7: 102,928,408 V260A probably benign Het
Pde4b G T 4: 102,605,295 D723Y probably benign Het
Pdzrn3 T C 6: 101,150,954 E917G probably damaging Het
Ppip5k1 C T 2: 121,337,627 R715H probably damaging Het
Prkdc T A 16: 15,687,352 probably benign Het
Ptp4a3 A G 15: 73,753,769 Y21C probably damaging Het
Ptprk C A 10: 28,592,767 probably benign Het
Rfesd C A 13: 76,002,872 probably null Het
Rtel1 A T 2: 181,351,863 K592* probably null Het
Siah1a T A 8: 86,725,270 K195N probably damaging Het
Slc5a5 G T 8: 70,888,587 D369E probably damaging Het
Slc6a6 A T 6: 91,724,910 I100F probably benign Het
Smtn T C 11: 3,517,781 I913V probably benign Het
Stk17b A G 1: 53,761,076 S248P probably damaging Het
Sun1 C T 5: 139,225,438 H149Y probably damaging Het
Taar5 T C 10: 23,971,094 I130T possibly damaging Het
Tmem132b G T 5: 125,749,289 V448F probably damaging Het
Tmem94 C A 11: 115,794,328 N888K possibly damaging Het
Trpc1 T C 9: 95,706,843 N742S probably damaging Het
Ttbk2 T C 2: 120,806,849 T112A probably damaging Het
Tubb2a A T 13: 34,075,456 L117Q probably damaging Het
Vmn1r60 T A 7: 5,544,820 M94L probably benign Het
Vmn2r83 A G 10: 79,491,819 T754A probably benign Het
Other mutations in Nudt18
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1241:Nudt18 UTSW 14 70579427 missense probably benign 0.00
R1867:Nudt18 UTSW 14 70579895 missense probably damaging 1.00
R5016:Nudt18 UTSW 14 70579463 missense probably benign 0.28
R6270:Nudt18 UTSW 14 70579390 missense probably benign 0.12
R7078:Nudt18 UTSW 14 70579012 missense possibly damaging 0.50
R7247:Nudt18 UTSW 14 70577982 missense unknown
R7442:Nudt18 UTSW 14 70579358 missense probably benign 0.01
R7448:Nudt18 UTSW 14 70577949 start codon destroyed unknown
R7661:Nudt18 UTSW 14 70579836 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTAGGCGCCAAATTCTGC -3'
(R):5'- CAAAAGTAGTTTTCACCCCGAATC -3'

Sequencing Primer
(F):5'- TTCTGCCAACAAGCCATGC -3'
(R):5'- ATTCCTGGGTTCCGAAAAGC -3'
Posted On2014-08-25