Incidental Mutation 'R2033:Ppip5k1'
ID 221450
Institutional Source Beutler Lab
Gene Symbol Ppip5k1
Ensembl Gene ENSMUSG00000033526
Gene Name diphosphoinositol pentakisphosphate kinase 1
Synonyms B430315C20Rik, Hisppd2a
MMRRC Submission 040040-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.295) question?
Stock # R2033 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 121141042-121185877 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 121168108 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 715 (R715H)
Ref Sequence ENSEMBL: ENSMUSP00000106258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052029] [ENSMUST00000110625] [ENSMUST00000110626] [ENSMUST00000110627] [ENSMUST00000110628] [ENSMUST00000155568]
AlphaFold A2ARP1
Predicted Effect probably damaging
Transcript: ENSMUST00000052029
AA Change: R715H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057632
Gene: ENSMUSG00000033526
AA Change: R715H

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.8e-110 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110625
AA Change: R715H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106255
Gene: ENSMUSG00000033526
AA Change: R715H

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110626
AA Change: R715H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106256
Gene: ENSMUSG00000033526
AA Change: R715H

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 1.1e-135 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110627
AA Change: R715H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106257
Gene: ENSMUSG00000033526
AA Change: R715H

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110628
AA Change: R715H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106258
Gene: ENSMUSG00000033526
AA Change: R715H

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 886 3.9e-101 PFAM
low complexity region 1143 1161 N/A INTRINSIC
coiled coil region 1382 1410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127255
SMART Domains Protein: ENSMUSP00000118597
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
Pfam:His_Phos_2 1 54 6.7e-9 PFAM
low complexity region 142 162 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132617
Predicted Effect probably benign
Transcript: ENSMUST00000132613
Predicted Effect probably benign
Transcript: ENSMUST00000155568
SMART Domains Protein: ENSMUSP00000116335
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
Pfam:His_Phos_2 1 107 8.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132114
SMART Domains Protein: ENSMUSP00000117948
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
Pfam:His_Phos_2 1 117 1.4e-30 PFAM
Meta Mutation Damage Score 0.8893 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual functional inositol kinase. The encoded enzyme converts inositol hexakisphosphate to diphosphoinositol pentakisphosphate and diphosphoinositol pentakisphosphate to bis-diphosphoinositol tetrakisphosphate. This protein may be important for intracellular signaling pathways. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 15.[provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,182,953 (GRCm39) T172A probably benign Het
Atp6v1c1 T C 15: 38,674,210 (GRCm39) probably null Het
Bpifc G A 10: 85,836,496 (GRCm39) T3I possibly damaging Het
Car12 A G 9: 66,624,840 (GRCm39) probably null Het
Ccrl2 A G 9: 110,884,938 (GRCm39) F187L possibly damaging Het
Cep250 G A 2: 155,812,812 (GRCm39) R544H probably damaging Het
Col4a3 T G 1: 82,695,732 (GRCm39) probably benign Het
Cyb5r2 T C 7: 107,356,114 (GRCm39) probably null Het
Elfn2 A G 15: 78,556,096 (GRCm39) V817A probably damaging Het
Eln C T 5: 134,738,960 (GRCm39) probably null Het
Eml5 T C 12: 98,757,645 (GRCm39) E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,504,875 (GRCm39) probably null Het
Galnt11 C T 5: 25,452,536 (GRCm39) T16I probably damaging Het
Gars1 C T 6: 55,054,708 (GRCm39) H672Y probably benign Het
Gpr155 T A 2: 73,178,526 (GRCm39) H726L probably benign Het
Inpp1 T A 1: 52,829,332 (GRCm39) N229I possibly damaging Het
Isg20 A C 7: 78,566,281 (GRCm39) I77L probably damaging Het
Kit G C 5: 75,797,977 (GRCm39) D422H possibly damaging Het
Lonp2 A G 8: 87,435,570 (GRCm39) E602G possibly damaging Het
Mink1 T C 11: 70,503,334 (GRCm39) V1143A probably damaging Het
Myh6 A C 14: 55,201,102 (GRCm39) L120R probably benign Het
Myo18a T A 11: 77,733,925 (GRCm39) probably null Het
Nphs2 T C 1: 156,151,308 (GRCm39) V249A probably damaging Het
Npsr1 A G 9: 24,224,648 (GRCm39) K342E probably benign Het
Nrros C T 16: 31,962,975 (GRCm39) W311* probably null Het
Nudt18 G T 14: 70,817,056 (GRCm39) G162V possibly damaging Het
Odam A G 5: 88,040,278 (GRCm39) D248G probably benign Het
Or1e30 T C 11: 73,678,264 (GRCm39) S167P probably benign Het
Or4c119 A G 2: 88,987,498 (GRCm39) V7A probably damaging Het
Or51d1 A G 7: 102,348,369 (GRCm39) E308G probably benign Het
Or51h5 T C 7: 102,577,615 (GRCm39) V260A probably benign Het
Or8b3 G T 9: 38,314,669 (GRCm39) M166I probably damaging Het
Pde4b G T 4: 102,462,492 (GRCm39) D723Y probably benign Het
Pdzrn3 T C 6: 101,127,915 (GRCm39) E917G probably damaging Het
Prkdc T A 16: 15,505,216 (GRCm39) probably benign Het
Ptp4a3 A G 15: 73,625,618 (GRCm39) Y21C probably damaging Het
Ptprk C A 10: 28,468,763 (GRCm39) probably benign Het
Rfesd C A 13: 76,150,991 (GRCm39) probably null Het
Rtel1 A T 2: 180,993,656 (GRCm39) K592* probably null Het
Siah1a T A 8: 87,451,898 (GRCm39) K195N probably damaging Het
Slc5a5 G T 8: 71,341,231 (GRCm39) D369E probably damaging Het
Slc6a6 A T 6: 91,701,891 (GRCm39) I100F probably benign Het
Smtn T C 11: 3,467,781 (GRCm39) I913V probably benign Het
Stk17b A G 1: 53,800,235 (GRCm39) S248P probably damaging Het
Sun1 C T 5: 139,211,193 (GRCm39) H149Y probably damaging Het
Taar5 T C 10: 23,846,992 (GRCm39) I130T possibly damaging Het
Tmem132b G T 5: 125,826,353 (GRCm39) V448F probably damaging Het
Tmem94 C A 11: 115,685,154 (GRCm39) N888K possibly damaging Het
Trpc1 T C 9: 95,588,896 (GRCm39) N742S probably damaging Het
Ttbk2 T C 2: 120,637,330 (GRCm39) T112A probably damaging Het
Tubb2a A T 13: 34,259,439 (GRCm39) L117Q probably damaging Het
Vmn1r60 T A 7: 5,547,819 (GRCm39) M94L probably benign Het
Vmn2r83 A G 10: 79,327,653 (GRCm39) T754A probably benign Het
Other mutations in Ppip5k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Ppip5k1 APN 2 121,177,839 (GRCm39) missense probably damaging 1.00
IGL01154:Ppip5k1 APN 2 121,173,660 (GRCm39) missense probably damaging 1.00
IGL01341:Ppip5k1 APN 2 121,173,691 (GRCm39) nonsense probably null
IGL01704:Ppip5k1 APN 2 121,142,555 (GRCm39) missense possibly damaging 0.74
IGL01949:Ppip5k1 APN 2 121,168,341 (GRCm39) missense probably benign
IGL02101:Ppip5k1 APN 2 121,162,089 (GRCm39) missense possibly damaging 0.84
IGL02499:Ppip5k1 APN 2 121,162,034 (GRCm39) splice site probably null
IGL02701:Ppip5k1 APN 2 121,147,130 (GRCm39) splice site probably null
IGL03188:Ppip5k1 APN 2 121,157,327 (GRCm39) unclassified probably benign
boca UTSW 2 121,142,450 (GRCm39) missense probably damaging 0.96
lapidus UTSW 2 121,167,944 (GRCm39) missense probably benign 0.29
Roca UTSW 2 121,167,232 (GRCm39) missense probably damaging 0.98
R0363:Ppip5k1 UTSW 2 121,177,836 (GRCm39) missense probably damaging 1.00
R1315:Ppip5k1 UTSW 2 121,142,486 (GRCm39) missense probably benign 0.13
R1664:Ppip5k1 UTSW 2 121,167,663 (GRCm39) missense probably benign 0.02
R1753:Ppip5k1 UTSW 2 121,173,112 (GRCm39) missense probably damaging 1.00
R1759:Ppip5k1 UTSW 2 121,181,067 (GRCm39) missense probably benign 0.32
R1763:Ppip5k1 UTSW 2 121,179,028 (GRCm39) missense probably damaging 1.00
R2037:Ppip5k1 UTSW 2 121,173,674 (GRCm39) missense probably damaging 1.00
R2066:Ppip5k1 UTSW 2 121,173,352 (GRCm39) unclassified probably benign
R2103:Ppip5k1 UTSW 2 121,152,134 (GRCm39) splice site probably null
R3414:Ppip5k1 UTSW 2 121,158,142 (GRCm39) missense probably damaging 0.97
R4022:Ppip5k1 UTSW 2 121,168,108 (GRCm39) missense probably damaging 1.00
R4569:Ppip5k1 UTSW 2 121,174,044 (GRCm39) missense possibly damaging 0.69
R4783:Ppip5k1 UTSW 2 121,171,329 (GRCm39) missense possibly damaging 0.95
R4843:Ppip5k1 UTSW 2 121,157,368 (GRCm39) missense probably damaging 1.00
R4981:Ppip5k1 UTSW 2 121,142,871 (GRCm39) missense probably damaging 1.00
R5353:Ppip5k1 UTSW 2 121,142,201 (GRCm39) missense probably benign 0.00
R5493:Ppip5k1 UTSW 2 121,167,253 (GRCm39) missense probably damaging 1.00
R5654:Ppip5k1 UTSW 2 121,147,157 (GRCm39) missense probably benign 0.00
R5835:Ppip5k1 UTSW 2 121,168,380 (GRCm39) missense probably benign 0.01
R5987:Ppip5k1 UTSW 2 121,180,972 (GRCm39) nonsense probably null
R6076:Ppip5k1 UTSW 2 121,167,591 (GRCm39) missense probably null 1.00
R6088:Ppip5k1 UTSW 2 121,167,944 (GRCm39) missense probably benign 0.29
R6276:Ppip5k1 UTSW 2 121,153,684 (GRCm39) unclassified probably benign
R6555:Ppip5k1 UTSW 2 121,168,093 (GRCm39) missense probably damaging 0.99
R6878:Ppip5k1 UTSW 2 121,142,417 (GRCm39) missense probably benign 0.00
R7075:Ppip5k1 UTSW 2 121,152,231 (GRCm39) missense probably damaging 1.00
R7251:Ppip5k1 UTSW 2 121,178,052 (GRCm39) missense probably benign 0.05
R7332:Ppip5k1 UTSW 2 121,142,450 (GRCm39) missense probably damaging 0.96
R7359:Ppip5k1 UTSW 2 121,171,329 (GRCm39) missense possibly damaging 0.95
R7462:Ppip5k1 UTSW 2 121,167,232 (GRCm39) missense probably damaging 0.98
R7568:Ppip5k1 UTSW 2 121,168,096 (GRCm39) missense probably damaging 1.00
R7654:Ppip5k1 UTSW 2 121,179,040 (GRCm39) missense probably damaging 1.00
R7678:Ppip5k1 UTSW 2 121,168,142 (GRCm39) missense probably damaging 1.00
R7841:Ppip5k1 UTSW 2 121,173,276 (GRCm39) missense probably benign 0.13
R7877:Ppip5k1 UTSW 2 121,147,235 (GRCm39) missense probably benign 0.01
R7896:Ppip5k1 UTSW 2 121,177,811 (GRCm39) missense probably damaging 1.00
R7901:Ppip5k1 UTSW 2 121,142,390 (GRCm39) missense probably damaging 0.99
R7911:Ppip5k1 UTSW 2 121,173,139 (GRCm39) missense possibly damaging 0.89
R8167:Ppip5k1 UTSW 2 121,173,282 (GRCm39) nonsense probably null
R8179:Ppip5k1 UTSW 2 121,172,095 (GRCm39) critical splice donor site probably null
R8766:Ppip5k1 UTSW 2 121,166,919 (GRCm39) nonsense probably null
R8954:Ppip5k1 UTSW 2 121,153,701 (GRCm39) unclassified probably benign
R8981:Ppip5k1 UTSW 2 121,158,121 (GRCm39) unclassified probably benign
R9127:Ppip5k1 UTSW 2 121,158,125 (GRCm39) critical splice donor site probably null
R9165:Ppip5k1 UTSW 2 121,162,045 (GRCm39) missense probably damaging 1.00
R9244:Ppip5k1 UTSW 2 121,164,932 (GRCm39) missense probably benign 0.30
R9338:Ppip5k1 UTSW 2 121,153,827 (GRCm39) missense
R9662:Ppip5k1 UTSW 2 121,174,054 (GRCm39) missense probably benign 0.15
X0020:Ppip5k1 UTSW 2 121,172,136 (GRCm39) missense probably damaging 0.99
Z1176:Ppip5k1 UTSW 2 121,168,347 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCCCTTATGTGAGACCCACC -3'
(R):5'- CCCAGCTCTGTAGGTTGGTATG -3'

Sequencing Primer
(F):5'- CTGGGGAATGACCACGTCAG -3'
(R):5'- GTTGGTATGAATACTACTGACCGCC -3'
Posted On 2014-08-25