Incidental Mutation 'R1992:Dnah7a'
ID223515
Institutional Source Beutler Lab
Gene Symbol Dnah7a
Ensembl Gene ENSMUSG00000096141
Gene Namedynein, axonemal, heavy chain 7A
SynonymsDnahc7a, Dnahc7, LOC381341
MMRRC Submission 040003-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R1992 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location53397006-53706784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 53582676 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 1097 (K1097Q)
Ref Sequence ENSEMBL: ENSMUSP00000092571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094964]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094964
AA Change: K1097Q

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092571
Gene: ENSMUSG00000096141
AA Change: K1097Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 504 537 N/A INTRINSIC
Pfam:DHC_N2 756 1165 3.1e-149 PFAM
AAA 1320 1459 2.46e-1 SMART
Blast:AAA 1601 1879 1e-87 BLAST
AAA 1968 2116 5.39e-2 SMART
Pfam:AAA_8 2303 2574 6.9e-75 PFAM
Pfam:MT 2586 2936 2.1e-55 PFAM
Pfam:AAA_9 2957 3182 1.3e-98 PFAM
Pfam:Dynein_heavy 3318 4020 2.3e-287 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,338,206 D89G probably damaging Het
1600015I10Rik T A 6: 48,930,769 H234Q probably damaging Het
2310009B15Rik T C 1: 138,853,642 T90A probably damaging Het
4430402I18Rik A G 19: 28,948,624 F130L probably damaging Het
4932438A13Rik A T 3: 37,000,032 H3100L probably benign Het
A930011G23Rik T C 5: 99,233,925 D326G possibly damaging Het
Abcc2 A T 19: 43,807,142 I446F probably damaging Het
Adamts14 A G 10: 61,198,660 Y1150H probably benign Het
Adgrl2 A G 3: 148,817,244 I217T possibly damaging Het
Afap1l1 A T 18: 61,741,771 Y446* probably null Het
Aimp2 G A 5: 143,906,730 A14V probably damaging Het
Akap8 G A 17: 32,316,612 H143Y probably damaging Het
Aldh2 A T 5: 121,575,963 V207E possibly damaging Het
Armc3 T C 2: 19,293,142 Y575H probably damaging Het
Arpp21 T C 9: 112,157,793 E230G probably damaging Het
Arrdc3 G A 13: 80,883,689 D14N probably damaging Het
Atn1 A G 6: 124,745,328 probably benign Het
Atxn7l1 G A 12: 33,358,744 D302N probably damaging Het
Bbs1 T A 19: 4,891,708 H518L probably benign Het
Bmpr1a C A 14: 34,425,093 G241C probably damaging Het
Cacna1b G A 2: 24,732,306 P222L probably damaging Het
Calcrl T C 2: 84,370,511 Y63C probably damaging Het
Cand2 A G 6: 115,785,132 H173R possibly damaging Het
Cap2 T A 13: 46,637,881 Y175N possibly damaging Het
Card14 A T 11: 119,321,821 probably null Het
Cd3d T A 9: 44,985,001 Y29* probably null Het
Cd4 A G 6: 124,867,688 V378A possibly damaging Het
Cluh A T 11: 74,660,002 H318L probably damaging Het
Clvs1 T A 4: 9,281,899 D114E probably benign Het
Cnot4 T A 6: 35,023,409 T548S probably benign Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Cr2 G A 1: 195,154,150 P1278S possibly damaging Het
Crebbp A T 16: 4,128,697 probably null Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Doc2a T A 7: 126,851,807 probably null Het
Dpp10 A T 1: 123,905,106 V48E probably null Het
Dsg2 A G 18: 20,601,473 K836R probably damaging Het
Egr2 T C 10: 67,540,027 V164A probably damaging Het
Erbin A T 13: 103,833,713 S1132T probably benign Het
Espn T A 4: 152,128,555 probably null Het
Fam83b A G 9: 76,492,022 S600P probably benign Het
Fanca A T 8: 123,297,812 N425K possibly damaging Het
Flot2 C T 11: 78,058,619 L294F probably damaging Het
Frs2 A G 10: 117,074,554 V301A probably benign Het
Fv1 T A 4: 147,869,161 N61K possibly damaging Het
Fxr2 A G 11: 69,649,833 E339G possibly damaging Het
Gck T C 11: 5,906,515 Y214C probably damaging Het
Gm4858 G T 3: 93,074,037 A121S probably benign Het
Gm5346 T C 8: 43,627,139 K16R probably benign Het
Gm9573 A T 17: 35,618,708 S1529T probably benign Het
Golga3 C G 5: 110,192,973 T551R probably damaging Het
Gorab A G 1: 163,397,056 S59P probably damaging Het
Gsdme C T 6: 50,208,122 V451M probably damaging Het
H2-Bl A C 17: 36,081,046 I216S probably damaging Het
Herc4 T A 10: 63,245,964 V22E possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hoxa2 A T 6: 52,164,596 S17T probably damaging Het
Hs3st5 A G 10: 36,832,886 Y139C probably damaging Het
Ism1 G A 2: 139,746,017 V221I probably benign Het
Kalrn T G 16: 33,975,738 L1222F probably damaging Het
Kdm4c A G 4: 74,343,394 D602G possibly damaging Het
Ktn1 A G 14: 47,695,521 K711E probably damaging Het
Lce1k A T 3: 92,806,818 C20S unknown Het
Macf1 A G 4: 123,456,695 S3792P probably damaging Het
Maml3 C T 3: 51,690,757 M189I probably benign Het
Mcc C A 18: 44,491,315 E213* probably null Het
Mep1a T G 17: 43,502,682 I13L probably benign Het
Mkrn2 G T 6: 115,609,601 C16F probably damaging Het
Mlh1 C T 9: 111,228,563 A727T probably damaging Het
Naa16 T C 14: 79,356,491 Y344C probably damaging Het
Nebl T A 2: 17,452,510 I80F probably damaging Het
Nlrc4 T A 17: 74,445,633 Y585F probably benign Het
Nrcam A G 12: 44,540,970 K149R probably damaging Het
Nufip1 T A 14: 76,134,847 I467N probably damaging Het
Nup133 A G 8: 123,906,221 I1057T possibly damaging Het
Obscn A T 11: 58,995,827 probably benign Het
Olfr1113 T A 2: 87,213,244 C117* probably null Het
Olfr173 A G 16: 58,796,946 V300A probably benign Het
Olfr177 A C 16: 58,872,511 I213R probably benign Het
Pi4k2a A T 19: 42,115,938 I380F probably damaging Het
Piezo2 A T 18: 63,074,662 L1426Q probably null Het
Pik3cg A T 12: 32,204,025 D654E possibly damaging Het
Poli G T 18: 70,508,987 P714Q probably damaging Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Ptprz1 A T 6: 22,959,748 K81N probably benign Het
Rbm19 T C 5: 120,133,883 probably null Het
Sec24a C T 11: 51,736,363 V241I probably benign Het
Sgk3 A G 1: 9,880,342 T160A possibly damaging Het
Slc1a4 A G 11: 20,304,375 I497T probably benign Het
Slc26a9 A T 1: 131,762,794 D512V probably damaging Het
Slc43a3 C T 2: 84,957,740 R489C probably damaging Het
Slc5a12 T A 2: 110,621,744 F327L probably benign Het
Slitrk3 A G 3: 73,049,771 V556A possibly damaging Het
Spib T C 7: 44,528,857 E180G probably benign Het
Spint2 T A 7: 29,259,408 N128Y probably damaging Het
Spx G A 6: 142,418,519 G102E probably benign Het
Spz1 T A 13: 92,575,658 E103D possibly damaging Het
Sstr2 T C 11: 113,624,669 I138T probably benign Het
Sytl3 T A 17: 6,733,049 I206N possibly damaging Het
Tcaf2 T C 6: 42,629,857 T388A probably benign Het
Thap12 T C 7: 98,716,365 V580A possibly damaging Het
Tlr5 T A 1: 182,974,347 D405E probably damaging Het
Tnxb T C 17: 34,671,904 V407A probably damaging Het
Tpx2 T A 2: 152,890,624 M606K probably benign Het
Trim43a T G 9: 88,584,259 L211R probably damaging Het
Trim46 A T 3: 89,237,701 Y489N probably damaging Het
Ttc28 C T 5: 111,276,322 S1485L probably benign Het
Ttll8 T C 15: 88,914,451 T694A probably benign Het
Txnl1 T C 18: 63,679,514 T70A probably benign Het
Ube3a C T 7: 59,303,787 A823V probably damaging Het
Ubqln5 C A 7: 104,129,534 V28F probably damaging Het
Ulk1 T A 5: 110,787,151 Q972L probably damaging Het
Unc93b1 T C 19: 3,944,062 Y398H probably benign Het
Usp1 A G 4: 98,934,294 D615G probably benign Het
Utp15 A G 13: 98,250,912 C385R probably benign Het
Vmn2r91 T A 17: 18,135,880 V603D probably damaging Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt8a A G 18: 34,544,884 D115G probably damaging Het
Yjefn3 A T 8: 69,888,995 probably null Het
Ywhab A T 2: 164,011,887 I95F probably damaging Het
Zfp143 C T 7: 110,061,282 probably benign Het
Zfp607b C G 7: 27,702,524 T135R possibly damaging Het
Zfp970 A G 2: 177,474,870 Q79R possibly damaging Het
Other mutations in Dnah7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dnah7a APN 1 53419684 missense probably damaging 0.99
IGL00510:Dnah7a APN 1 53501542 missense probably damaging 1.00
IGL00545:Dnah7a APN 1 53457746 missense possibly damaging 0.87
IGL01320:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01322:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01357:Dnah7a APN 1 53662381 missense probably benign
IGL01417:Dnah7a APN 1 53584600 missense probably benign 0.01
IGL01508:Dnah7a APN 1 53627072 missense probably benign 0.00
IGL01511:Dnah7a APN 1 53419595 missense probably damaging 1.00
IGL01545:Dnah7a APN 1 53518782 missense probably benign
IGL01575:Dnah7a APN 1 53427820 splice site probably benign
IGL01667:Dnah7a APN 1 53547292 missense probably damaging 1.00
IGL01712:Dnah7a APN 1 53423270 missense probably benign 0.23
IGL01824:Dnah7a APN 1 53504270 missense probably benign
IGL01829:Dnah7a APN 1 53618068 missense possibly damaging 0.64
IGL01861:Dnah7a APN 1 53640349 missense probably benign 0.01
IGL01861:Dnah7a APN 1 53584449 splice site probably benign
IGL01984:Dnah7a APN 1 53702015 splice site probably null
IGL02056:Dnah7a APN 1 53504342 missense probably benign 0.17
IGL02069:Dnah7a APN 1 53561894 splice site probably benign
IGL02072:Dnah7a APN 1 53605827 missense probably damaging 1.00
IGL02110:Dnah7a APN 1 53411580 missense possibly damaging 0.52
IGL02120:Dnah7a APN 1 53495717 missense possibly damaging 0.46
IGL02128:Dnah7a APN 1 53437513 missense probably damaging 1.00
IGL02135:Dnah7a APN 1 53623473 missense probably benign 0.01
IGL02151:Dnah7a APN 1 53472864 missense probably benign 0.08
IGL02156:Dnah7a APN 1 53419723 missense probably benign 0.27
IGL02270:Dnah7a APN 1 53472893 missense possibly damaging 0.93
IGL02282:Dnah7a APN 1 53643510 missense possibly damaging 0.93
IGL02328:Dnah7a APN 1 53524937 critical splice donor site probably null
IGL02370:Dnah7a APN 1 53635397 missense probably benign 0.00
IGL02420:Dnah7a APN 1 53686543 missense probably benign
IGL02458:Dnah7a APN 1 53618328 nonsense probably null
IGL02489:Dnah7a APN 1 53647322 missense possibly damaging 0.94
IGL02554:Dnah7a APN 1 53618046 missense possibly damaging 0.93
IGL02578:Dnah7a APN 1 53432915 missense probably benign 0.00
IGL02646:Dnah7a APN 1 53525035 missense probably damaging 0.99
IGL02675:Dnah7a APN 1 53504024 missense possibly damaging 0.96
IGL02688:Dnah7a APN 1 53444472 missense possibly damaging 0.93
IGL02858:Dnah7a APN 1 53472959 splice site probably benign
IGL02874:Dnah7a APN 1 53605814 missense possibly damaging 0.70
IGL02887:Dnah7a APN 1 53522360 missense possibly damaging 0.46
IGL02894:Dnah7a APN 1 53577328 missense probably benign 0.27
IGL02926:Dnah7a APN 1 53495950 missense possibly damaging 0.64
IGL03113:Dnah7a APN 1 53433004 missense possibly damaging 0.64
IGL03156:Dnah7a APN 1 53605824 missense probably damaging 0.97
IGL03195:Dnah7a APN 1 53419607 missense probably damaging 1.00
IGL03209:Dnah7a APN 1 53686614 splice site probably benign
IGL03214:Dnah7a APN 1 53522209 critical splice donor site probably null
IGL03242:Dnah7a APN 1 53620723 missense probably benign 0.02
IGL03251:Dnah7a APN 1 53647274 missense probably benign
IGL03265:Dnah7a APN 1 53528848 missense probably benign
IGL03277:Dnah7a APN 1 53630322 missense probably benign 0.00
IGL03278:Dnah7a APN 1 53496965 missense probably benign 0.07
IGL03356:Dnah7a APN 1 53503934 missense probably benign 0.01
PIT4378001:Dnah7a UTSW 1 53531203 missense probably damaging 0.99
R0046:Dnah7a UTSW 1 53456874 splice site probably null
R0051:Dnah7a UTSW 1 53521086 splice site probably benign
R0082:Dnah7a UTSW 1 53518708 missense probably damaging 1.00
R0111:Dnah7a UTSW 1 53468684 missense probably benign 0.03
R0122:Dnah7a UTSW 1 53397142 missense probably damaging 1.00
R0245:Dnah7a UTSW 1 53501526 missense probably damaging 1.00
R0278:Dnah7a UTSW 1 53504146 missense probably benign 0.00
R0309:Dnah7a UTSW 1 53405690 missense probably damaging 0.97
R0334:Dnah7a UTSW 1 53433054 missense possibly damaging 0.61
R0392:Dnah7a UTSW 1 53504198 missense probably damaging 0.97
R0452:Dnah7a UTSW 1 53605819 missense probably benign 0.00
R0511:Dnah7a UTSW 1 53497126 missense probably benign
R0576:Dnah7a UTSW 1 53636087 missense probably benign 0.12
R0592:Dnah7a UTSW 1 53456612 missense possibly damaging 0.91
R0628:Dnah7a UTSW 1 53497105 missense probably benign 0.18
R0689:Dnah7a UTSW 1 53620681 nonsense probably null
R0735:Dnah7a UTSW 1 53544511 missense possibly damaging 0.70
R0800:Dnah7a UTSW 1 53565696 missense probably damaging 1.00
R0829:Dnah7a UTSW 1 53504079 missense probably benign 0.07
R0842:Dnah7a UTSW 1 53501674 missense possibly damaging 0.88
R0879:Dnah7a UTSW 1 53427860 missense possibly damaging 0.85
R1331:Dnah7a UTSW 1 53468669 missense probably damaging 0.99
R1418:Dnah7a UTSW 1 53647236 splice site probably benign
R1421:Dnah7a UTSW 1 53540873 splice site probably benign
R1445:Dnah7a UTSW 1 53528797 missense probably benign 0.02
R1473:Dnah7a UTSW 1 53496014 missense probably benign 0.00
R1538:Dnah7a UTSW 1 53495989 missense possibly damaging 0.71
R1742:Dnah7a UTSW 1 53456684 missense probably benign 0.39
R1754:Dnah7a UTSW 1 53504185 missense probably benign 0.18
R1754:Dnah7a UTSW 1 53561900 critical splice donor site probably null
R1773:Dnah7a UTSW 1 53432887 splice site probably null
R1779:Dnah7a UTSW 1 53577223 missense probably benign
R1816:Dnah7a UTSW 1 53631742 splice site probably benign
R1817:Dnah7a UTSW 1 53559148 missense probably benign
R1818:Dnah7a UTSW 1 53559148 missense probably benign
R1819:Dnah7a UTSW 1 53559148 missense probably benign
R1873:Dnah7a UTSW 1 53456532 splice site probably benign
R1875:Dnah7a UTSW 1 53456532 splice site probably benign
R1884:Dnah7a UTSW 1 53541000 missense probably damaging 0.99
R1902:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1903:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1908:Dnah7a UTSW 1 53631562 missense probably benign
R1959:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1960:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1985:Dnah7a UTSW 1 53503934 missense probably benign 0.01
R2037:Dnah7a UTSW 1 53582582 missense probably benign 0.00
R2074:Dnah7a UTSW 1 53457696 missense probably benign 0.45
R2076:Dnah7a UTSW 1 53503809 missense probably benign 0.01
R2124:Dnah7a UTSW 1 53496942 missense possibly damaging 0.58
R2191:Dnah7a UTSW 1 53605875 missense possibly damaging 0.54
R2211:Dnah7a UTSW 1 53479773 missense probably benign 0.21
R2220:Dnah7a UTSW 1 53521174 missense probably benign
R2355:Dnah7a UTSW 1 53582502 missense probably benign 0.00
R2495:Dnah7a UTSW 1 53605881 missense probably damaging 1.00
R2901:Dnah7a UTSW 1 53427872 missense probably damaging 0.99
R2911:Dnah7a UTSW 1 53427824 critical splice donor site probably null
R2993:Dnah7a UTSW 1 53503554 missense probably damaging 1.00
R3522:Dnah7a UTSW 1 53618116 missense probably damaging 1.00
R3683:Dnah7a UTSW 1 53444516 missense probably benign
R3723:Dnah7a UTSW 1 53447346 missense probably benign 0.04
R3847:Dnah7a UTSW 1 53501656 missense probably benign 0.01
R4002:Dnah7a UTSW 1 53631681 missense probably benign
R4009:Dnah7a UTSW 1 53525005 missense probably damaging 1.00
R4063:Dnah7a UTSW 1 53425217 missense probably benign
R4193:Dnah7a UTSW 1 53447334 missense probably benign 0.00
R4236:Dnah7a UTSW 1 53447365 missense probably benign 0.00
R4399:Dnah7a UTSW 1 53518727 missense probably damaging 1.00
R4469:Dnah7a UTSW 1 53444526 missense probably benign 0.01
R4494:Dnah7a UTSW 1 53449038 missense probably benign 0.01
R4569:Dnah7a UTSW 1 53411659 missense probably benign 0.01
R4609:Dnah7a UTSW 1 53456657 missense possibly damaging 0.80
R4632:Dnah7a UTSW 1 53427951 missense probably damaging 0.97
R4703:Dnah7a UTSW 1 53447317 critical splice donor site probably null
R4781:Dnah7a UTSW 1 53425208 missense probably benign 0.28
R4854:Dnah7a UTSW 1 53706729 utr 5 prime probably benign
R4932:Dnah7a UTSW 1 53503578 missense possibly damaging 0.90
R4976:Dnah7a UTSW 1 53698692 missense probably benign
R5000:Dnah7a UTSW 1 53567042 missense probably damaging 1.00
R5023:Dnah7a UTSW 1 53647248 nonsense probably null
R5026:Dnah7a UTSW 1 53662498 missense probably damaging 0.99
R5050:Dnah7a UTSW 1 53497096 missense probably benign 0.01
R5119:Dnah7a UTSW 1 53698692 missense probably benign
R5151:Dnah7a UTSW 1 53620770 missense probably benign 0.00
R5155:Dnah7a UTSW 1 53643495 missense probably benign 0.01
R5180:Dnah7a UTSW 1 53423287 missense probably damaging 0.97
R5228:Dnah7a UTSW 1 53437609 critical splice acceptor site probably null
R5237:Dnah7a UTSW 1 53447531 intron probably null
R5267:Dnah7a UTSW 1 53479692 missense probably damaging 1.00
R5334:Dnah7a UTSW 1 53503646 missense probably benign 0.00
R5358:Dnah7a UTSW 1 53547172 missense probably damaging 1.00
R5401:Dnah7a UTSW 1 53631653 missense probably benign 0.01
R5412:Dnah7a UTSW 1 53635344 missense probably benign
R5496:Dnah7a UTSW 1 53457768 missense probably benign
R5531:Dnah7a UTSW 1 53419748 missense possibly damaging 0.50
R5536:Dnah7a UTSW 1 53425253 missense probably benign
R5543:Dnah7a UTSW 1 53504069 missense probably damaging 1.00
R5597:Dnah7a UTSW 1 53534452 missense probably benign 0.00
R5609:Dnah7a UTSW 1 53582594 missense probably benign 0.03
R5643:Dnah7a UTSW 1 53405707 missense probably benign
R5644:Dnah7a UTSW 1 53540979 missense probably benign 0.33
R5689:Dnah7a UTSW 1 53405698 missense possibly damaging 0.87
R5715:Dnah7a UTSW 1 53413778 missense probably damaging 1.00
R5780:Dnah7a UTSW 1 53483319 missense probably benign 0.03
R5893:Dnah7a UTSW 1 53457785 missense possibly damaging 0.66
R5946:Dnah7a UTSW 1 53559308 missense probably damaging 1.00
R5995:Dnah7a UTSW 1 53620670 missense probably benign 0.00
R6102:Dnah7a UTSW 1 53559140 missense probably benign 0.00
R6108:Dnah7a UTSW 1 53456845 missense probably damaging 1.00
R6133:Dnah7a UTSW 1 53419655 missense probably benign 0.05
R6168:Dnah7a UTSW 1 53411568 missense probably damaging 1.00
R6175:Dnah7a UTSW 1 53433022 missense probably damaging 1.00
R6211:Dnah7a UTSW 1 53419636 missense probably damaging 0.99
R6282:Dnah7a UTSW 1 53503601 missense probably damaging 1.00
R6329:Dnah7a UTSW 1 53541114 missense probably damaging 1.00
R6344:Dnah7a UTSW 1 53397190 missense probably benign 0.02
R6530:Dnah7a UTSW 1 53503697 missense probably benign 0.04
R6574:Dnah7a UTSW 1 53456534 critical splice donor site probably null
R6608:Dnah7a UTSW 1 53525118 missense probably benign
R6625:Dnah7a UTSW 1 53565757 missense probably benign 0.05
R6661:Dnah7a UTSW 1 53623450 missense probably benign 0.00
R6681:Dnah7a UTSW 1 53521226 critical splice acceptor site probably null
R6747:Dnah7a UTSW 1 53636062 missense probably benign 0.01
R6774:Dnah7a UTSW 1 53698651 missense probably benign
R6823:Dnah7a UTSW 1 53456704 missense probably benign
R6900:Dnah7a UTSW 1 53662351 missense probably damaging 0.97
R6940:Dnah7a UTSW 1 53631677 missense probably benign 0.09
R6956:Dnah7a UTSW 1 53577287 missense probably benign 0.02
R6978:Dnah7a UTSW 1 53662367 missense probably null
R6988:Dnah7a UTSW 1 53582625 missense possibly damaging 0.62
R7026:Dnah7a UTSW 1 53504289 missense probably benign
R7027:Dnah7a UTSW 1 53631506 missense probably benign 0.01
R7033:Dnah7a UTSW 1 53479661 missense probably damaging 1.00
R7072:Dnah7a UTSW 1 53419753 missense probably benign 0.00
R7096:Dnah7a UTSW 1 53483440 missense possibly damaging 0.90
R7142:Dnah7a UTSW 1 53413768 nonsense probably null
R7144:Dnah7a UTSW 1 53698708 splice site probably null
R7167:Dnah7a UTSW 1 53503776 missense probably benign 0.00
R7182:Dnah7a UTSW 1 53620461 intron probably null
R7196:Dnah7a UTSW 1 53684841 missense probably benign 0.00
R7206:Dnah7a UTSW 1 53698633 nonsense probably null
R7215:Dnah7a UTSW 1 53618350 missense probably damaging 0.99
R7224:Dnah7a UTSW 1 53397261 missense probably benign 0.00
R7264:Dnah7a UTSW 1 53518814 missense probably benign
R7282:Dnah7a UTSW 1 53684900 critical splice acceptor site probably null
R7365:Dnah7a UTSW 1 53497138 missense probably benign
R7392:Dnah7a UTSW 1 53501661 missense probably benign 0.00
R7454:Dnah7a UTSW 1 53518764 missense probably benign
R7471:Dnah7a UTSW 1 53419699 missense probably damaging 1.00
R7547:Dnah7a UTSW 1 53663837 missense probably benign 0.00
R7554:Dnah7a UTSW 1 53528698 missense possibly damaging 0.87
R7655:Dnah7a UTSW 1 53496005 missense possibly damaging 0.50
R7656:Dnah7a UTSW 1 53496005 missense possibly damaging 0.50
R7666:Dnah7a UTSW 1 53547297 missense probably benign 0.00
R7721:Dnah7a UTSW 1 53631683 missense probably benign
X0027:Dnah7a UTSW 1 53472930 missense probably damaging 1.00
Z1088:Dnah7a UTSW 1 53468643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTTAATCATAGTCCTCTCTAACTC -3'
(R):5'- GCTATGCACATTGGAAGACTGG -3'

Sequencing Primer
(F):5'- TCATAGTCCTCTCTAACTCAACCAAC -3'
(R):5'- GCTAGAGTGCTGTACCTAAAACTGC -3'
Posted On2014-08-25