Incidental Mutation 'R1902:Dnah7a'
ID212280
Institutional Source Beutler Lab
Gene Symbol Dnah7a
Ensembl Gene ENSMUSG00000096141
Gene Namedynein, axonemal, heavy chain 7A
SynonymsDnahc7a, Dnahc7, LOC381341
MMRRC Submission 039922-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R1902 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location53397006-53706784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53535478 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1709 (D1709G)
Ref Sequence ENSEMBL: ENSMUSP00000092571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094964]
Predicted Effect probably damaging
Transcript: ENSMUST00000094964
AA Change: D1709G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092571
Gene: ENSMUSG00000096141
AA Change: D1709G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 504 537 N/A INTRINSIC
Pfam:DHC_N2 756 1165 3.1e-149 PFAM
AAA 1320 1459 2.46e-1 SMART
Blast:AAA 1601 1879 1e-87 BLAST
AAA 1968 2116 5.39e-2 SMART
Pfam:AAA_8 2303 2574 6.9e-75 PFAM
Pfam:MT 2586 2936 2.1e-55 PFAM
Pfam:AAA_9 2957 3182 1.3e-98 PFAM
Pfam:Dynein_heavy 3318 4020 2.3e-287 PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C T 12: 18,534,003 Q355* probably null Het
Acacb A T 5: 114,165,734 R73* probably null Het
Adra1a T C 14: 66,638,235 S220P probably benign Het
Ano2 A T 6: 125,872,684 E126D probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgap45 C A 10: 80,025,466 Q488K probably damaging Het
Arhgef7 C A 8: 11,808,713 probably null Het
Atxn7l3b A G 10: 112,928,673 I17T probably benign Het
BC003331 T A 1: 150,388,609 probably null Het
Bpifb9a A T 2: 154,261,991 N118I probably benign Het
Btbd9 A T 17: 30,530,228 D37E probably damaging Het
C8a T C 4: 104,856,601 probably null Het
Capn13 G A 17: 73,326,361 S535F probably damaging Het
Carns1 G T 19: 4,166,338 P615Q probably damaging Het
Casz1 T C 4: 148,936,195 I479T possibly damaging Het
Ccdc88a G T 11: 29,461,788 M532I probably benign Het
Cdc42bpb T G 12: 111,326,016 S362R probably damaging Het
Ceacam11 A T 7: 17,975,327 H150L probably benign Het
Cfap44 A C 16: 44,422,374 T714P probably benign Het
Cnot1 T C 8: 95,743,121 I1369V possibly damaging Het
Cpeb1 T C 7: 81,372,119 D92G probably benign Het
Cped1 T A 6: 22,120,981 probably null Het
Csf1r A G 18: 61,130,141 T896A probably damaging Het
Csf3r T C 4: 126,042,918 F658S probably damaging Het
Cts6 A T 13: 61,201,515 Y126* probably null Het
Cul7 T C 17: 46,655,740 L365P probably damaging Het
Cxcl5 T C 5: 90,759,785 V72A probably damaging Het
Cyp4v3 T A 8: 45,306,952 H521L probably benign Het
Dct T C 14: 118,034,278 N380S probably benign Het
Dnah1 T C 14: 31,319,759 D85G probably damaging Het
Dnaic1 A T 4: 41,625,319 K428* probably null Het
Dsc1 A T 18: 20,095,988 V415D probably damaging Het
E2f8 T C 7: 48,871,172 H467R probably benign Het
Eddm3b T A 14: 51,116,864 I103N probably damaging Het
Fam71b A T 11: 46,407,011 T381S probably benign Het
Gal3st2c T G 1: 94,008,889 N185K probably damaging Het
Ganc T C 2: 120,446,482 L675P probably damaging Het
Gdf9 G A 11: 53,436,953 M245I probably benign Het
Gm21886 G A 18: 80,089,418 T175I probably damaging Het
Gria2 A G 3: 80,722,108 L269P probably damaging Het
Grm8 T C 6: 27,429,482 Y471C probably damaging Het
Gucy2g T A 19: 55,210,237 T825S probably benign Het
H2-Bl A T 17: 36,083,953 M16K probably damaging Het
Iffo2 T C 4: 139,607,701 S124P probably damaging Het
Igf1r T C 7: 68,201,249 Y931H possibly damaging Het
Il22ra1 A T 4: 135,750,908 Q430L probably damaging Het
Il23r A C 6: 67,423,734 D537E probably benign Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Itgb4 T C 11: 115,980,738 V179A probably damaging Het
Itpr2 T A 6: 146,229,703 H1968L probably damaging Het
Kdm4a A G 4: 118,160,399 V490A probably benign Het
Kif13a A T 13: 46,788,162 D946E probably benign Het
Klhl22 T A 16: 17,771,787 I104N probably damaging Het
Klk6 A C 7: 43,826,057 M1L probably benign Het
Krt78 A T 15: 101,946,963 C804* probably null Het
Larp7 A T 3: 127,540,578 N533K probably damaging Het
Lrit3 T C 3: 129,791,246 T288A probably benign Het
Lrp11 T A 10: 7,623,780 L245Q probably damaging Het
Lrp1b T C 2: 40,860,661 S2964G probably damaging Het
Lrrc66 C T 5: 73,607,622 V693M probably damaging Het
Macf1 T A 4: 123,471,165 M3268L probably benign Het
Mad1l1 A G 5: 140,303,688 S161P possibly damaging Het
Mettl25 A G 10: 105,826,087 S341P probably damaging Het
Morc3 A G 16: 93,870,497 T588A probably damaging Het
Mospd3 A G 5: 137,600,415 S21P probably damaging Het
Mrpl57 T A 14: 57,826,729 F71L probably damaging Het
Mtbp T C 15: 55,606,715 L594S probably damaging Het
Mthfd2 T C 6: 83,306,731 N323S probably damaging Het
Muc5b G T 7: 141,864,105 S3596I possibly damaging Het
Mug1 A G 6: 121,881,821 D1166G probably benign Het
Nav1 T G 1: 135,472,410 N474T probably benign Het
Ncoa1 A T 12: 4,339,049 D75E possibly damaging Het
Ncor1 A C 11: 62,338,158 I958S probably damaging Het
Nefm T C 14: 68,124,114 S234G probably benign Het
Nlrp4c T C 7: 6,065,819 S240P probably damaging Het
Nox3 C T 17: 3,670,017 V298M probably damaging Het
Ntn4 A G 10: 93,707,372 D320G possibly damaging Het
Nudt13 C G 14: 20,310,641 T174R probably damaging Het
Olfr1002 T C 2: 85,647,857 S155G possibly damaging Het
Olfr119 T A 17: 37,701,421 H250Q probably damaging Het
Olfr1245 A T 2: 89,575,603 L41Q possibly damaging Het
Olfr1512 T G 14: 52,372,717 Q112P possibly damaging Het
Olfr209 A T 16: 59,362,163 D18E probably benign Het
Olfr355 T C 2: 36,927,185 I310V probably benign Het
Olfr430 T C 1: 174,070,126 V276A probably damaging Het
Olfr437 T A 6: 43,167,723 probably null Het
Olfr812 G T 10: 129,842,506 P179T probably benign Het
Olfr967 T C 9: 39,750,806 V140A probably benign Het
Opn1sw T A 6: 29,379,804 N144Y possibly damaging Het
Osbpl5 T C 7: 143,703,181 D404G possibly damaging Het
Parp14 C T 16: 35,853,518 probably null Het
Pde3a C A 6: 141,498,770 N1101K probably benign Het
Plcb1 G A 2: 134,813,613 V38I possibly damaging Het
Plec T A 15: 76,175,551 E3417D probably damaging Het
Ppfibp2 C T 7: 107,746,378 P869L probably damaging Het
Ppp1r12a T A 10: 108,198,891 I99N probably damaging Het
Pramel5 G A 4: 144,273,863 Q48* probably null Het
Prr13 C A 15: 102,460,698 probably benign Het
Psg22 T A 7: 18,724,438 Y312* probably null Het
Ptchd4 A T 17: 42,503,616 I803L probably benign Het
Rasa4 A G 5: 136,091,238 D56G probably benign Het
Rif1 T A 2: 52,116,673 N2206K possibly damaging Het
Robo1 A G 16: 72,960,204 Q351R probably null Het
Samd4 T C 14: 47,074,128 F81S probably damaging Het
Sh3pxd2b T C 11: 32,423,559 *909Q probably null Het
Slc25a45 A G 19: 5,884,522 R173G probably damaging Het
Smarca1 G A X: 47,849,963 Q723* probably null Het
Smoc1 T C 12: 81,104,671 I54T probably benign Het
Spef2 G T 15: 9,607,377 R1319S probably damaging Het
Steap3 T G 1: 120,241,734 I240L probably benign Het
Stmn4 C T 14: 66,355,609 L13F probably damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Syt3 T C 7: 44,390,516 S58P possibly damaging Het
Tas2r125 T C 6: 132,910,176 F176L probably benign Het
Tbc1d19 T A 5: 53,829,353 C35S probably benign Het
Tcaf3 T C 6: 42,593,552 E422G possibly damaging Het
Tekt4 T A 17: 25,471,858 F46Y possibly damaging Het
Tnfaip3 T C 10: 19,008,189 K148E probably benign Het
Trrap T G 5: 144,816,053 I1813R probably damaging Het
Ttc29 A G 8: 78,251,732 E137G probably benign Het
Tubgcp6 C A 15: 89,116,241 R307L possibly damaging Het
Tyro3 T C 2: 119,801,695 I81T possibly damaging Het
Upp2 T G 2: 58,771,452 M71R probably damaging Het
Utp20 G T 10: 88,753,026 T2427K probably benign Het
Vcl T A 14: 20,982,699 L122Q probably damaging Het
Vmn1r213 A C 13: 23,012,306 N353T possibly damaging Het
Vwa5b2 G T 16: 20,604,832 S1165I possibly damaging Het
Zfp869 T C 8: 69,707,438 K162E probably benign Het
Other mutations in Dnah7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dnah7a APN 1 53419684 missense probably damaging 0.99
IGL00510:Dnah7a APN 1 53501542 missense probably damaging 1.00
IGL00545:Dnah7a APN 1 53457746 missense possibly damaging 0.87
IGL01320:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01322:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01357:Dnah7a APN 1 53662381 missense probably benign
IGL01417:Dnah7a APN 1 53584600 missense probably benign 0.01
IGL01508:Dnah7a APN 1 53627072 missense probably benign 0.00
IGL01511:Dnah7a APN 1 53419595 missense probably damaging 1.00
IGL01545:Dnah7a APN 1 53518782 missense probably benign
IGL01575:Dnah7a APN 1 53427820 splice site probably benign
IGL01667:Dnah7a APN 1 53547292 missense probably damaging 1.00
IGL01712:Dnah7a APN 1 53423270 missense probably benign 0.23
IGL01824:Dnah7a APN 1 53504270 missense probably benign
IGL01829:Dnah7a APN 1 53618068 missense possibly damaging 0.64
IGL01861:Dnah7a APN 1 53640349 missense probably benign 0.01
IGL01861:Dnah7a APN 1 53584449 splice site probably benign
IGL01984:Dnah7a APN 1 53702015 splice site probably null
IGL02056:Dnah7a APN 1 53504342 missense probably benign 0.17
IGL02069:Dnah7a APN 1 53561894 splice site probably benign
IGL02072:Dnah7a APN 1 53605827 missense probably damaging 1.00
IGL02110:Dnah7a APN 1 53411580 missense possibly damaging 0.52
IGL02120:Dnah7a APN 1 53495717 missense possibly damaging 0.46
IGL02128:Dnah7a APN 1 53437513 missense probably damaging 1.00
IGL02135:Dnah7a APN 1 53623473 missense probably benign 0.01
IGL02151:Dnah7a APN 1 53472864 missense probably benign 0.08
IGL02156:Dnah7a APN 1 53419723 missense probably benign 0.27
IGL02270:Dnah7a APN 1 53472893 missense possibly damaging 0.93
IGL02282:Dnah7a APN 1 53643510 missense possibly damaging 0.93
IGL02328:Dnah7a APN 1 53524937 critical splice donor site probably null
IGL02370:Dnah7a APN 1 53635397 missense probably benign 0.00
IGL02420:Dnah7a APN 1 53686543 missense probably benign
IGL02458:Dnah7a APN 1 53618328 nonsense probably null
IGL02489:Dnah7a APN 1 53647322 missense possibly damaging 0.94
IGL02554:Dnah7a APN 1 53618046 missense possibly damaging 0.93
IGL02578:Dnah7a APN 1 53432915 missense probably benign 0.00
IGL02646:Dnah7a APN 1 53525035 missense probably damaging 0.99
IGL02675:Dnah7a APN 1 53504024 missense possibly damaging 0.96
IGL02688:Dnah7a APN 1 53444472 missense possibly damaging 0.93
IGL02858:Dnah7a APN 1 53472959 splice site probably benign
IGL02874:Dnah7a APN 1 53605814 missense possibly damaging 0.70
IGL02887:Dnah7a APN 1 53522360 missense possibly damaging 0.46
IGL02894:Dnah7a APN 1 53577328 missense probably benign 0.27
IGL02926:Dnah7a APN 1 53495950 missense possibly damaging 0.64
IGL03113:Dnah7a APN 1 53433004 missense possibly damaging 0.64
IGL03156:Dnah7a APN 1 53605824 missense probably damaging 0.97
IGL03195:Dnah7a APN 1 53419607 missense probably damaging 1.00
IGL03209:Dnah7a APN 1 53686614 splice site probably benign
IGL03214:Dnah7a APN 1 53522209 critical splice donor site probably null
IGL03242:Dnah7a APN 1 53620723 missense probably benign 0.02
IGL03251:Dnah7a APN 1 53647274 missense probably benign
IGL03265:Dnah7a APN 1 53528848 missense probably benign
IGL03277:Dnah7a APN 1 53630322 missense probably benign 0.00
IGL03278:Dnah7a APN 1 53496965 missense probably benign 0.07
IGL03356:Dnah7a APN 1 53503934 missense probably benign 0.01
PIT4378001:Dnah7a UTSW 1 53531203 missense probably damaging 0.99
R0046:Dnah7a UTSW 1 53456874 splice site probably null
R0051:Dnah7a UTSW 1 53521086 splice site probably benign
R0082:Dnah7a UTSW 1 53518708 missense probably damaging 1.00
R0111:Dnah7a UTSW 1 53468684 missense probably benign 0.03
R0122:Dnah7a UTSW 1 53397142 missense probably damaging 1.00
R0245:Dnah7a UTSW 1 53501526 missense probably damaging 1.00
R0278:Dnah7a UTSW 1 53504146 missense probably benign 0.00
R0309:Dnah7a UTSW 1 53405690 missense probably damaging 0.97
R0334:Dnah7a UTSW 1 53433054 missense possibly damaging 0.61
R0392:Dnah7a UTSW 1 53504198 missense probably damaging 0.97
R0452:Dnah7a UTSW 1 53605819 missense probably benign 0.00
R0511:Dnah7a UTSW 1 53497126 missense probably benign
R0576:Dnah7a UTSW 1 53636087 missense probably benign 0.12
R0592:Dnah7a UTSW 1 53456612 missense possibly damaging 0.91
R0628:Dnah7a UTSW 1 53497105 missense probably benign 0.18
R0689:Dnah7a UTSW 1 53620681 nonsense probably null
R0735:Dnah7a UTSW 1 53544511 missense possibly damaging 0.70
R0800:Dnah7a UTSW 1 53565696 missense probably damaging 1.00
R0829:Dnah7a UTSW 1 53504079 missense probably benign 0.07
R0842:Dnah7a UTSW 1 53501674 missense possibly damaging 0.88
R0879:Dnah7a UTSW 1 53427860 missense possibly damaging 0.85
R1331:Dnah7a UTSW 1 53468669 missense probably damaging 0.99
R1418:Dnah7a UTSW 1 53647236 splice site probably benign
R1421:Dnah7a UTSW 1 53540873 splice site probably benign
R1445:Dnah7a UTSW 1 53528797 missense probably benign 0.02
R1473:Dnah7a UTSW 1 53496014 missense probably benign 0.00
R1538:Dnah7a UTSW 1 53495989 missense possibly damaging 0.71
R1742:Dnah7a UTSW 1 53456684 missense probably benign 0.39
R1754:Dnah7a UTSW 1 53504185 missense probably benign 0.18
R1754:Dnah7a UTSW 1 53561900 critical splice donor site probably null
R1773:Dnah7a UTSW 1 53432887 splice site probably null
R1779:Dnah7a UTSW 1 53577223 missense probably benign
R1816:Dnah7a UTSW 1 53631742 splice site probably benign
R1817:Dnah7a UTSW 1 53559148 missense probably benign
R1818:Dnah7a UTSW 1 53559148 missense probably benign
R1819:Dnah7a UTSW 1 53559148 missense probably benign
R1873:Dnah7a UTSW 1 53456532 splice site probably benign
R1875:Dnah7a UTSW 1 53456532 splice site probably benign
R1884:Dnah7a UTSW 1 53541000 missense probably damaging 0.99
R1903:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1908:Dnah7a UTSW 1 53631562 missense probably benign
R1959:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1960:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1985:Dnah7a UTSW 1 53503934 missense probably benign 0.01
R1992:Dnah7a UTSW 1 53582676 missense possibly damaging 0.91
R2037:Dnah7a UTSW 1 53582582 missense probably benign 0.00
R2074:Dnah7a UTSW 1 53457696 missense probably benign 0.45
R2076:Dnah7a UTSW 1 53503809 missense probably benign 0.01
R2124:Dnah7a UTSW 1 53496942 missense possibly damaging 0.58
R2191:Dnah7a UTSW 1 53605875 missense possibly damaging 0.54
R2211:Dnah7a UTSW 1 53479773 missense probably benign 0.21
R2220:Dnah7a UTSW 1 53521174 missense probably benign
R2355:Dnah7a UTSW 1 53582502 missense probably benign 0.00
R2495:Dnah7a UTSW 1 53605881 missense probably damaging 1.00
R2901:Dnah7a UTSW 1 53427872 missense probably damaging 0.99
R2911:Dnah7a UTSW 1 53427824 critical splice donor site probably null
R2993:Dnah7a UTSW 1 53503554 missense probably damaging 1.00
R3522:Dnah7a UTSW 1 53618116 missense probably damaging 1.00
R3683:Dnah7a UTSW 1 53444516 missense probably benign
R3723:Dnah7a UTSW 1 53447346 missense probably benign 0.04
R3847:Dnah7a UTSW 1 53501656 missense probably benign 0.01
R4002:Dnah7a UTSW 1 53631681 missense probably benign
R4009:Dnah7a UTSW 1 53525005 missense probably damaging 1.00
R4063:Dnah7a UTSW 1 53425217 missense probably benign
R4193:Dnah7a UTSW 1 53447334 missense probably benign 0.00
R4236:Dnah7a UTSW 1 53447365 missense probably benign 0.00
R4399:Dnah7a UTSW 1 53518727 missense probably damaging 1.00
R4469:Dnah7a UTSW 1 53444526 missense probably benign 0.01
R4494:Dnah7a UTSW 1 53449038 missense probably benign 0.01
R4569:Dnah7a UTSW 1 53411659 missense probably benign 0.01
R4609:Dnah7a UTSW 1 53456657 missense possibly damaging 0.80
R4632:Dnah7a UTSW 1 53427951 missense probably damaging 0.97
R4703:Dnah7a UTSW 1 53447317 critical splice donor site probably null
R4781:Dnah7a UTSW 1 53425208 missense probably benign 0.28
R4854:Dnah7a UTSW 1 53706729 utr 5 prime probably benign
R4932:Dnah7a UTSW 1 53503578 missense possibly damaging 0.90
R4976:Dnah7a UTSW 1 53698692 missense probably benign
R5000:Dnah7a UTSW 1 53567042 missense probably damaging 1.00
R5023:Dnah7a UTSW 1 53647248 nonsense probably null
R5026:Dnah7a UTSW 1 53662498 missense probably damaging 0.99
R5050:Dnah7a UTSW 1 53497096 missense probably benign 0.01
R5119:Dnah7a UTSW 1 53698692 missense probably benign
R5151:Dnah7a UTSW 1 53620770 missense probably benign 0.00
R5155:Dnah7a UTSW 1 53643495 missense probably benign 0.01
R5180:Dnah7a UTSW 1 53423287 missense probably damaging 0.97
R5228:Dnah7a UTSW 1 53437609 critical splice acceptor site probably null
R5237:Dnah7a UTSW 1 53447531 intron probably null
R5267:Dnah7a UTSW 1 53479692 missense probably damaging 1.00
R5334:Dnah7a UTSW 1 53503646 missense probably benign 0.00
R5358:Dnah7a UTSW 1 53547172 missense probably damaging 1.00
R5401:Dnah7a UTSW 1 53631653 missense probably benign 0.01
R5412:Dnah7a UTSW 1 53635344 missense probably benign
R5496:Dnah7a UTSW 1 53457768 missense probably benign
R5531:Dnah7a UTSW 1 53419748 missense possibly damaging 0.50
R5536:Dnah7a UTSW 1 53425253 missense probably benign
R5543:Dnah7a UTSW 1 53504069 missense probably damaging 1.00
R5597:Dnah7a UTSW 1 53534452 missense probably benign 0.00
R5609:Dnah7a UTSW 1 53582594 missense probably benign 0.03
R5643:Dnah7a UTSW 1 53405707 missense probably benign
R5644:Dnah7a UTSW 1 53540979 missense probably benign 0.33
R5689:Dnah7a UTSW 1 53405698 missense possibly damaging 0.87
R5715:Dnah7a UTSW 1 53413778 missense probably damaging 1.00
R5780:Dnah7a UTSW 1 53483319 missense probably benign 0.03
R5893:Dnah7a UTSW 1 53457785 missense possibly damaging 0.66
R5946:Dnah7a UTSW 1 53559308 missense probably damaging 1.00
R5995:Dnah7a UTSW 1 53620670 missense probably benign 0.00
R6102:Dnah7a UTSW 1 53559140 missense probably benign 0.00
R6108:Dnah7a UTSW 1 53456845 missense probably damaging 1.00
R6133:Dnah7a UTSW 1 53419655 missense probably benign 0.05
R6168:Dnah7a UTSW 1 53411568 missense probably damaging 1.00
R6175:Dnah7a UTSW 1 53433022 missense probably damaging 1.00
R6211:Dnah7a UTSW 1 53419636 missense probably damaging 0.99
R6282:Dnah7a UTSW 1 53503601 missense probably damaging 1.00
R6329:Dnah7a UTSW 1 53541114 missense probably damaging 1.00
R6344:Dnah7a UTSW 1 53397190 missense probably benign 0.02
R6530:Dnah7a UTSW 1 53503697 missense probably benign 0.04
R6574:Dnah7a UTSW 1 53456534 critical splice donor site probably null
R6608:Dnah7a UTSW 1 53525118 missense probably benign
R6625:Dnah7a UTSW 1 53565757 missense probably benign 0.05
R6661:Dnah7a UTSW 1 53623450 missense probably benign 0.00
R6681:Dnah7a UTSW 1 53521226 critical splice acceptor site probably null
R6747:Dnah7a UTSW 1 53636062 missense probably benign 0.01
R6774:Dnah7a UTSW 1 53698651 missense probably benign
R6823:Dnah7a UTSW 1 53456704 missense probably benign
R6900:Dnah7a UTSW 1 53662351 missense probably damaging 0.97
R6940:Dnah7a UTSW 1 53631677 missense probably benign 0.09
R6956:Dnah7a UTSW 1 53577287 missense probably benign 0.02
R6978:Dnah7a UTSW 1 53662367 missense probably null
R6988:Dnah7a UTSW 1 53582625 missense possibly damaging 0.62
R7026:Dnah7a UTSW 1 53504289 missense probably benign
R7027:Dnah7a UTSW 1 53631506 missense probably benign 0.01
R7033:Dnah7a UTSW 1 53479661 missense probably damaging 1.00
R7072:Dnah7a UTSW 1 53419753 missense probably benign 0.00
R7096:Dnah7a UTSW 1 53483440 missense possibly damaging 0.90
R7142:Dnah7a UTSW 1 53413768 nonsense probably null
R7144:Dnah7a UTSW 1 53698708 splice site probably null
R7167:Dnah7a UTSW 1 53503776 missense probably benign 0.00
R7182:Dnah7a UTSW 1 53620461 intron probably null
R7196:Dnah7a UTSW 1 53684841 missense probably benign 0.00
R7206:Dnah7a UTSW 1 53698633 nonsense probably null
R7215:Dnah7a UTSW 1 53618350 missense probably damaging 0.99
R7224:Dnah7a UTSW 1 53397261 missense probably benign 0.00
R7264:Dnah7a UTSW 1 53518814 missense probably benign
R7282:Dnah7a UTSW 1 53684900 critical splice acceptor site probably null
R7365:Dnah7a UTSW 1 53497138 missense probably benign
R7392:Dnah7a UTSW 1 53501661 missense probably benign 0.00
R7454:Dnah7a UTSW 1 53518764 missense probably benign
R7471:Dnah7a UTSW 1 53419699 missense probably damaging 1.00
R7547:Dnah7a UTSW 1 53663837 missense probably benign 0.00
R7554:Dnah7a UTSW 1 53528698 missense possibly damaging 0.87
R7655:Dnah7a UTSW 1 53496005 missense possibly damaging 0.50
R7656:Dnah7a UTSW 1 53496005 missense possibly damaging 0.50
R7666:Dnah7a UTSW 1 53547297 missense probably benign 0.00
R7721:Dnah7a UTSW 1 53631683 missense probably benign
X0027:Dnah7a UTSW 1 53472930 missense probably damaging 1.00
Z1088:Dnah7a UTSW 1 53468643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGACCACAGATTGCTTTCAC -3'
(R):5'- CATATGTAGACTTCTTCATCTACGC -3'

Sequencing Primer
(F):5'- GGACCACAGATTGCTTTCACAATGG -3'
(R):5'- GGATGTATACATGCACCTGCCTG -3'
Posted On2014-06-30