Incidental Mutation 'R2094:Olfr725'
ID231992
Institutional Source Beutler Lab
Gene Symbol Olfr725
Ensembl Gene ENSMUSG00000068437
Gene Nameolfactory receptor 725
SynonymsMOR246-3, GA_x6K02T2PMLR-5725741-5724776, MOR246-7_p
MMRRC Submission 040098-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R2094 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50034314-50040375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50034714 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 230 (S230T)
Ref Sequence ENSEMBL: ENSMUSP00000145828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089844] [ENSMUST00000206920]
Predicted Effect probably damaging
Transcript: ENSMUST00000089844
AA Change: S230T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087282
Gene: ENSMUSG00000068437
AA Change: S230T

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.7e-46 PFAM
Pfam:7TM_GPCR_Srsx 36 282 1.8e-7 PFAM
Pfam:7tm_1 41 287 5.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206920
AA Change: S230T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,846 I169V probably benign Het
Arrdc5 A G 17: 56,297,856 S144P probably benign Het
Astn1 A G 1: 158,667,609 M92V probably benign Het
Atg5 A G 10: 44,319,548 I189M probably damaging Het
Atmin A G 8: 116,957,538 T646A probably damaging Het
Atp1a2 G A 1: 172,287,433 R262W probably damaging Het
Atp6v1g2 A G 17: 35,236,809 K16E probably damaging Het
Bex6 G A 16: 32,186,460 E29K possibly damaging Het
Casd1 A G 6: 4,608,705 Y101C probably damaging Het
Cdx1 T C 18: 61,035,912 D70G possibly damaging Het
Cebpz T C 17: 78,935,554 T224A probably benign Het
Cep170b T C 12: 112,735,730 V319A possibly damaging Het
Chrna2 C T 14: 66,149,463 R353W possibly damaging Het
Chst5 A T 8: 111,890,544 V148E probably benign Het
Clhc1 T A 11: 29,557,771 W162R probably benign Het
Csmd1 T A 8: 16,079,978 Q1710L probably damaging Het
Ddb1 A C 19: 10,612,936 M276L probably benign Het
Dot1l C T 10: 80,785,878 R455C probably damaging Het
Dync2h1 A G 9: 7,148,735 V903A probably benign Het
Eno1b T C 18: 48,047,475 V240A possibly damaging Het
Erich1 T G 8: 14,090,527 probably benign Het
Ermp1 A C 19: 29,639,928 S227A probably benign Het
Etv1 C A 12: 38,835,116 P143Q probably null Het
Gimap8 A T 6: 48,650,568 I159F probably benign Het
Gm12666 A G 4: 92,191,656 S32P probably damaging Het
Gm8251 A C 1: 44,059,730 I736S probably benign Het
Gpr4 G A 7: 19,222,578 V142M possibly damaging Het
Gucy1a1 C T 3: 82,113,332 C86Y probably benign Het
Ifngr2 T G 16: 91,561,779 probably null Het
Insrr A T 3: 87,803,181 N398I probably damaging Het
Iws1 A G 18: 32,084,666 E441G probably damaging Het
Megf10 A T 18: 57,281,713 K732* probably null Het
Mprip T A 11: 59,749,508 probably benign Het
Mrgprb8 T C 7: 48,389,205 V208A probably benign Het
Msc G C 1: 14,755,684 P22R probably benign Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Oxsr1 A C 9: 119,294,494 H71Q probably benign Het
Pkp2 T A 16: 16,246,967 W452R probably damaging Het
Prrc2b C T 2: 32,182,570 T20I probably damaging Het
Rasgrp3 T C 17: 75,503,141 S279P probably damaging Het
Rtl1 T A 12: 109,591,397 D1336V unknown Het
Serpina3m G T 12: 104,389,270 K65N probably benign Het
Serpine2 A G 1: 79,810,694 V182A probably damaging Het
Slc10a1 A G 12: 80,956,048 V272A possibly damaging Het
Slc25a29 A T 12: 108,827,432 N73K probably damaging Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Srrm2 T C 17: 23,812,429 probably benign Het
Stk11ip A G 1: 75,525,521 probably benign Het
Tcerg1 A G 18: 42,564,145 K767R possibly damaging Het
Tmem82 T C 4: 141,616,287 K224R probably benign Het
Tmprss11g A G 5: 86,499,556 L41S probably damaging Het
Trim42 T C 9: 97,366,097 N182S probably benign Het
Ttn T C 2: 76,830,088 T7430A probably benign Het
Wwp1 T C 4: 19,650,390 T259A probably benign Het
Other mutations in Olfr725
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Olfr725 APN 14 50035050 missense probably benign 0.29
IGL01412:Olfr725 APN 14 50035313 missense probably benign
IGL03241:Olfr725 APN 14 50035068 missense possibly damaging 0.70
IGL03268:Olfr725 APN 14 50034567 missense probably damaging 0.98
IGL03348:Olfr725 APN 14 50034755 missense probably benign 0.00
R0358:Olfr725 UTSW 14 50035286 missense probably damaging 0.97
R0577:Olfr725 UTSW 14 50034792 missense probably damaging 1.00
R2424:Olfr725 UTSW 14 50034824 missense probably damaging 1.00
R3421:Olfr725 UTSW 14 50034540 missense possibly damaging 0.66
R3422:Olfr725 UTSW 14 50034540 missense possibly damaging 0.66
R4436:Olfr725 UTSW 14 50034830 missense probably damaging 1.00
R4437:Olfr725 UTSW 14 50034830 missense probably damaging 1.00
R4438:Olfr725 UTSW 14 50034830 missense probably damaging 1.00
R4684:Olfr725 UTSW 14 50034830 missense probably damaging 1.00
R4717:Olfr725 UTSW 14 50035364 missense probably damaging 0.98
R5253:Olfr725 UTSW 14 50035288 missense possibly damaging 0.91
R5254:Olfr725 UTSW 14 50034678 missense possibly damaging 0.60
R5641:Olfr725 UTSW 14 50035289 missense probably benign 0.04
R5881:Olfr725 UTSW 14 50034987 missense probably benign 0.00
R5906:Olfr725 UTSW 14 50034849 missense probably benign 0.05
R6511:Olfr725 UTSW 14 50034809 missense probably damaging 1.00
R7837:Olfr725 UTSW 14 50034576 missense probably damaging 1.00
R7980:Olfr725 UTSW 14 50034795 missense probably damaging 1.00
R8118:Olfr725 UTSW 14 50035151 missense probably benign 0.13
X0062:Olfr725 UTSW 14 50034860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTTGACATAGCTGCTTTCAC -3'
(R):5'- TGGCATTCACTGTTAACTTGCC -3'

Sequencing Primer
(F):5'- CACATCTTTGTTTCTCAGAGTGTAG -3'
(R):5'- CACTGTTAACTTGCCATTTTGTG -3'
Posted On2014-09-18