Incidental Mutation 'R0194:Copg1'
ID 23296
Institutional Source Beutler Lab
Gene Symbol Copg1
Ensembl Gene ENSMUSG00000030058
Gene Name coatomer protein complex, subunit gamma 1
Synonyms D6Ertd71e, Copg, D6Wsu16e
MMRRC Submission 038453-MU
Accession Numbers

Genbank: NM_017477, NM_201244; MGI: 1858696

Essential gene? Probably essential (E-score: 0.967) question?
Stock # R0194 (G1)
Quality Score 172
Status Validated
Chromosome 6
Chromosomal Location 87887814-87913595 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 87904197 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113607]
AlphaFold Q9QZE5
Predicted Effect probably benign
Transcript: ENSMUST00000113607
SMART Domains Protein: ENSMUSP00000109237
Gene: ENSMUSG00000030058

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 539 4.1e-135 PFAM
Pfam:COP-gamma_platf 611 759 7.6e-64 PFAM
Pfam:Coatomer_g_Cpla 761 873 1.5e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205234
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
Allele List at MGI

All alleles(58) : Targeted, other(2) Gene trapped(56)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,197,207 (GRCm38) D122V probably damaging Het
4930553M12Rik T A 4: 88,868,243 (GRCm38) D46V unknown Het
Abcb9 A G 5: 124,077,295 (GRCm38) V461A probably damaging Het
Ackr4 T A 9: 104,099,480 (GRCm38) L89F probably benign Het
Acsf2 T C 11: 94,561,370 (GRCm38) T449A probably benign Het
Acsl4 C G X: 142,333,718 (GRCm38) G489R probably damaging Het
Actl6a T A 3: 32,725,320 (GRCm38) I399N probably damaging Het
Adamts19 G A 18: 59,011,148 (GRCm38) C934Y probably null Het
Adsl A G 15: 80,961,360 (GRCm38) E40G possibly damaging Het
AI481877 T A 4: 59,066,534 (GRCm38) probably benign Het
Alppl2 T G 1: 87,088,743 (GRCm38) D203A probably damaging Het
Asb10 C A 5: 24,537,932 (GRCm38) A268S probably benign Het
Atp9a T C 2: 168,643,885 (GRCm38) S832G probably benign Het
Bckdha A T 7: 25,631,450 (GRCm38) I297N probably damaging Het
Blm G A 7: 80,464,946 (GRCm38) probably benign Het
Cacna1h A G 17: 25,380,924 (GRCm38) probably benign Het
Camsap2 G A 1: 136,292,948 (GRCm38) Q298* probably null Het
Ccdc38 A T 10: 93,565,912 (GRCm38) K145* probably null Het
Cfap45 C T 1: 172,541,327 (GRCm38) T434M probably benign Het
Cfap54 A T 10: 93,034,662 (GRCm38) probably benign Het
Clcn6 G A 4: 148,012,756 (GRCm38) P618L probably damaging Het
Dctd T A 8: 48,112,078 (GRCm38) N79K probably benign Het
Dgkq A G 5: 108,654,644 (GRCm38) probably benign Het
Dntt A T 19: 41,038,970 (GRCm38) T159S possibly damaging Het
Doc2g G A 19: 4,003,656 (GRCm38) R29Q probably benign Het
Dsg3 A G 18: 20,540,142 (GRCm38) T957A probably damaging Het
Eif3c T A 7: 126,558,623 (GRCm38) probably benign Het
Ephb3 T A 16: 21,218,109 (GRCm38) D107E probably benign Het
Esrrb A T 12: 86,470,481 (GRCm38) D108V probably damaging Het
Exo1 A G 1: 175,892,030 (GRCm38) K214E probably damaging Het
Fam186a G A 15: 99,941,763 (GRCm38) T2200I possibly damaging Het
Fam227a C T 15: 79,640,669 (GRCm38) W194* probably null Het
Foxn4 A G 5: 114,259,748 (GRCm38) probably null Het
Gabbr2 T C 4: 46,787,565 (GRCm38) K366R possibly damaging Het
Garem2 T A 5: 30,113,930 (GRCm38) V130E probably damaging Het
Grin2b A G 6: 135,779,305 (GRCm38) F474S probably damaging Het
H2-M10.6 G T 17: 36,814,042 (GRCm38) V284F probably damaging Het
Helz2 C A 2: 181,232,759 (GRCm38) G1981C probably damaging Het
Hivep1 G T 13: 42,155,435 (GRCm38) V384F probably damaging Het
Hmox1 A G 8: 75,097,108 (GRCm38) T135A probably damaging Het
Hpse T C 5: 100,719,512 (GRCm38) D28G probably benign Het
Itm2b G T 14: 73,364,618 (GRCm38) D213E probably benign Het
Jakmip1 T A 5: 37,134,283 (GRCm38) M692K possibly damaging Het
Kdm3a T C 6: 71,624,594 (GRCm38) Q151R probably null Het
Limch1 C A 5: 66,999,273 (GRCm38) A517E probably benign Het
Lrit1 T A 14: 37,061,720 (GRCm38) L335Q probably damaging Het
Lrrc37a A G 11: 103,499,790 (GRCm38) V1603A possibly damaging Het
Mbtps1 T A 8: 119,535,369 (GRCm38) N347I probably damaging Het
Mier1 A T 4: 103,139,519 (GRCm38) probably null Het
Mt2 A T 8: 94,172,848 (GRCm38) M1L probably damaging Het
Mug1 A T 6: 121,840,107 (GRCm38) E45V probably damaging Het
Mybphl A G 3: 108,374,168 (GRCm38) K67E probably benign Het
Myh4 A G 11: 67,252,336 (GRCm38) K1030R probably damaging Het
Myl3 T A 9: 110,769,121 (GRCm38) D176E probably benign Het
Ncapg2 A G 12: 116,420,683 (GRCm38) probably null Het
Ndor1 T C 2: 25,248,706 (GRCm38) probably null Het
Nedd4 T G 9: 72,670,053 (GRCm38) N53K possibly damaging Het
Nek11 C A 9: 105,392,952 (GRCm38) A24S probably benign Het
Nudt19 G T 7: 35,551,514 (GRCm38) P267T probably benign Het
Olfml2b T C 1: 170,681,115 (GRCm38) M514T possibly damaging Het
Olfr304 A T 7: 86,386,374 (GRCm38) C95* probably null Het
Olfr424 A T 1: 174,136,761 (GRCm38) T6S probably benign Het
Olfr556 A G 7: 102,670,199 (GRCm38) D93G probably benign Het
Olfr699 C A 7: 106,790,823 (GRCm38) M59I probably benign Het
P3h1 T A 4: 119,237,952 (GRCm38) F302Y probably damaging Het
Pappa2 T A 1: 158,765,101 (GRCm38) probably benign Het
Pex2 A C 3: 5,561,364 (GRCm38) H128Q probably benign Het
Phf11d A C 14: 59,352,731 (GRCm38) L214R probably damaging Het
Plcg2 G A 8: 117,573,397 (GRCm38) probably benign Het
Ppargc1b A C 18: 61,307,945 (GRCm38) L634R possibly damaging Het
Prune1 A T 3: 95,262,360 (GRCm38) I177N probably damaging Het
Puf60 T C 15: 76,070,485 (GRCm38) D496G probably damaging Het
Rasl11b A G 5: 74,196,163 (GRCm38) probably null Het
Sdr42e1 A T 8: 117,663,109 (GRCm38) F264L probably damaging Het
Sec24b A T 3: 129,984,165 (GRCm38) probably null Het
Sgta G T 10: 81,051,059 (GRCm38) P79T probably benign Het
Shisa9 C T 16: 11,984,954 (GRCm38) T125M probably damaging Het
Slc12a2 A G 18: 57,930,211 (GRCm38) D921G probably damaging Het
Slc13a5 T A 11: 72,262,130 (GRCm38) I42L possibly damaging Het
Slc13a5 C T 11: 72,245,233 (GRCm38) V494I probably benign Het
Spire2 G A 8: 123,363,011 (GRCm38) probably benign Het
Sptbn4 G A 7: 27,404,911 (GRCm38) R962C probably benign Het
St8sia5 G A 18: 77,254,724 (GRCm38) V377I probably benign Het
Stag2 T G X: 42,206,137 (GRCm38) probably benign Het
Syne1 C A 10: 5,424,311 (GRCm38) M165I probably benign Het
Synm C A 7: 67,734,924 (GRCm38) V997L probably damaging Het
Tacc1 A G 8: 25,182,376 (GRCm38) S279P probably benign Het
Tbc1d10a T C 11: 4,212,901 (GRCm38) probably null Het
Tbc1d19 A G 5: 53,860,156 (GRCm38) T302A probably damaging Het
Tecpr1 A C 5: 144,218,517 (GRCm38) N74K probably damaging Het
Tmem120a T C 5: 135,742,398 (GRCm38) E28G possibly damaging Het
Tnfrsf1b A T 4: 145,224,812 (GRCm38) I186N probably benign Het
Trim55 A G 3: 19,661,861 (GRCm38) D195G probably benign Het
Trpm3 G T 19: 22,715,356 (GRCm38) probably null Het
Ttc39a T A 4: 109,444,179 (GRCm38) S571T probably benign Het
Vwf T G 6: 125,643,297 (GRCm38) I1646S probably benign Het
Wbp2nl T C 15: 82,314,282 (GRCm38) F340S possibly damaging Het
Yeats2 T C 16: 20,152,969 (GRCm38) M1T probably null Het
Zfp236 T A 18: 82,656,987 (GRCm38) E460V probably damaging Het
Zfp277 G A 12: 40,378,877 (GRCm38) probably benign Het
Zfp975 T A 7: 42,662,492 (GRCm38) K232N probably benign Het
Zxdc T C 6: 90,372,537 (GRCm38) probably benign Het
Other mutations in Copg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Copg1 APN 6 87,902,370 (GRCm38) missense possibly damaging 0.94
IGL00816:Copg1 APN 6 87,893,898 (GRCm38) missense possibly damaging 0.95
IGL02087:Copg1 APN 6 87,902,210 (GRCm38) missense possibly damaging 0.68
R0448:Copg1 UTSW 6 87,904,926 (GRCm38) missense probably benign
R0576:Copg1 UTSW 6 87,897,963 (GRCm38) missense probably damaging 1.00
R0701:Copg1 UTSW 6 87,894,107 (GRCm38) nonsense probably null
R1251:Copg1 UTSW 6 87,890,007 (GRCm38) nonsense probably null
R1707:Copg1 UTSW 6 87,905,210 (GRCm38) missense probably benign
R1845:Copg1 UTSW 6 87,893,818 (GRCm38) missense probably damaging 1.00
R3500:Copg1 UTSW 6 87,895,923 (GRCm38) splice site probably benign
R3952:Copg1 UTSW 6 87,905,216 (GRCm38) missense probably benign
R4283:Copg1 UTSW 6 87,908,545 (GRCm38) missense probably damaging 1.00
R4515:Copg1 UTSW 6 87,907,546 (GRCm38) intron probably benign
R4715:Copg1 UTSW 6 87,912,286 (GRCm38) nonsense probably null
R4797:Copg1 UTSW 6 87,903,468 (GRCm38) intron probably benign
R4864:Copg1 UTSW 6 87,889,696 (GRCm38) missense probably damaging 1.00
R4947:Copg1 UTSW 6 87,903,473 (GRCm38) splice site probably benign
R5265:Copg1 UTSW 6 87,892,270 (GRCm38) missense probably damaging 0.98
R5288:Copg1 UTSW 6 87,890,207 (GRCm38) missense possibly damaging 0.90
R5386:Copg1 UTSW 6 87,890,207 (GRCm38) missense possibly damaging 0.90
R5511:Copg1 UTSW 6 87,912,294 (GRCm38) missense probably damaging 0.99
R5670:Copg1 UTSW 6 87,912,235 (GRCm38) missense probably damaging 1.00
R5887:Copg1 UTSW 6 87,902,297 (GRCm38) missense probably damaging 1.00
R7014:Copg1 UTSW 6 87,902,340 (GRCm38) missense probably damaging 1.00
R7021:Copg1 UTSW 6 87,894,105 (GRCm38) missense possibly damaging 0.94
R7380:Copg1 UTSW 6 87,893,842 (GRCm38) missense probably damaging 0.98
R7392:Copg1 UTSW 6 87,890,275 (GRCm38) missense probably benign 0.01
R7629:Copg1 UTSW 6 87,894,169 (GRCm38) missense possibly damaging 0.90
R7704:Copg1 UTSW 6 87,907,958 (GRCm38) missense probably benign 0.13
R8060:Copg1 UTSW 6 87,909,721 (GRCm38) missense probably damaging 0.96
R8184:Copg1 UTSW 6 87,890,014 (GRCm38) missense probably damaging 1.00
R8683:Copg1 UTSW 6 87,892,655 (GRCm38) missense probably damaging 1.00
R9320:Copg1 UTSW 6 87,910,090 (GRCm38) missense possibly damaging 0.65
R9433:Copg1 UTSW 6 87,903,496 (GRCm38) missense possibly damaging 0.95
R9564:Copg1 UTSW 6 87,892,701 (GRCm38) missense probably damaging 0.97
R9660:Copg1 UTSW 6 87,902,243 (GRCm38) missense probably damaging 0.96
R9709:Copg1 UTSW 6 87,891,975 (GRCm38) missense probably benign 0.22
R9728:Copg1 UTSW 6 87,902,243 (GRCm38) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGAGAGCTGTCTACCACTGAGCTG -3'
(R):5'- TCCATTGACTGGATCAAGCCATGC -3'

Sequencing Primer
(F):5'- ACTGAGCTGCATCAGCC -3'
(R):5'- ATGCAGCCCTGGGTCTTC -3'
Posted On 2013-04-16