Incidental Mutation 'R2174:Col6a4'
ID237708
Institutional Source Beutler Lab
Gene Symbol Col6a4
Ensembl Gene ENSMUSG00000032572
Gene Namecollagen, type VI, alpha 4
SynonymsVwa6, 1110001D15Rik, EG235580, Dvwa
MMRRC Submission 040176-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2174 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location105989454-106096783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106060132 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1395 (D1395G)
Ref Sequence ENSEMBL: ENSMUSP00000112472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121963]
Predicted Effect probably damaging
Transcript: ENSMUST00000121963
AA Change: D1395G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: D1395G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWA 32 211 2.44e-35 SMART
VWA 233 410 8.67e-50 SMART
VWA 428 604 2.74e-29 SMART
VWA 632 816 4.78e-20 SMART
VWA 847 1019 3.02e-40 SMART
VWA 1028 1204 3.17e-43 SMART
VWA 1210 1391 4.73e-1 SMART
low complexity region 1444 1462 N/A INTRINSIC
PDB:3HR2|B 1469 1593 3e-7 PDB
low complexity region 1594 1622 N/A INTRINSIC
low complexity region 1625 1643 N/A INTRINSIC
low complexity region 1649 1671 N/A INTRINSIC
Pfam:Collagen 1684 1748 1.4e-9 PFAM
VWA 1774 1953 2.18e-14 SMART
VWA 1980 2174 1.89e-9 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C10Rik T C 7: 38,194,828 I95T possibly damaging Het
4930452B06Rik T C 14: 8,558,109 I159V probably benign Het
Adarb1 A G 10: 77,295,798 I619T probably benign Het
Aldh2 T C 5: 121,572,668 probably benign Het
Antxrl T A 14: 34,060,400 L180Q probably damaging Het
Asnsd1 A T 1: 53,347,601 I289N probably benign Het
Asxl3 T G 18: 22,453,644 S164A possibly damaging Het
Cacnb2 C T 2: 14,958,767 T108I probably benign Het
Capn2 A T 1: 182,479,725 I516N probably benign Het
Casc1 T C 6: 145,175,170 H641R probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cenpo T C 12: 4,217,318 K73R probably benign Het
Clasp1 A G 1: 118,560,095 H823R probably damaging Het
Ddx60 A G 8: 61,956,141 I404V probably damaging Het
Ddx60 G T 8: 62,017,200 M1407I probably benign Het
Dennd3 A T 15: 73,555,305 R844W probably damaging Het
Depdc1b A T 13: 108,362,253 K157* probably null Het
Dnajc1 T C 2: 18,307,951 D196G probably damaging Het
Fanca A G 8: 123,271,270 W1226R probably benign Het
Fbxl13 A G 5: 21,582,048 V297A possibly damaging Het
Fnta A T 8: 26,013,470 F96I possibly damaging Het
Fzd3 T C 14: 65,212,231 probably benign Het
Gckr T C 5: 31,327,009 V597A possibly damaging Het
Gm43302 T C 5: 105,274,350 K496R probably benign Het
Gm5283 A G 3: 17,230,841 noncoding transcript Het
Gm5724 A T 6: 141,727,593 Y406* probably null Het
Gm6741 A G 17: 91,236,904 I32V probably benign Het
Gnptab T A 10: 88,434,044 F870I probably damaging Het
Gpx8 G A 13: 113,045,606 P98S probably benign Het
Grm2 T C 9: 106,647,795 I574V probably benign Het
Gtf3c5 T C 2: 28,567,775 D468G probably benign Het
Hectd3 A T 4: 116,999,701 M482L probably benign Het
Ier5 G T 1: 155,098,853 P193H possibly damaging Het
Inpp4a A G 1: 37,396,130 N827S probably damaging Het
Kif13a A G 13: 46,769,176 L387P probably damaging Het
Map3k1 G C 13: 111,752,482 H1314D possibly damaging Het
Mbl2 G A 19: 30,234,012 C11Y possibly damaging Het
Msr1 A G 8: 39,631,340 L58P probably damaging Het
Mtmr10 T A 7: 64,336,764 F530Y possibly damaging Het
Myo7b A G 18: 31,983,557 L999P probably damaging Het
Myoz3 T C 18: 60,590,224 E8G probably benign Het
Naip6 C A 13: 100,298,987 M1009I probably benign Het
Nav2 T A 7: 49,452,663 M342K probably damaging Het
Ndufaf6 T C 4: 11,070,228 H131R probably benign Het
Nlrp4a T C 7: 26,449,424 L152P probably damaging Het
Olfr1413 A G 1: 92,573,657 N162S probably benign Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Prkdc A T 16: 15,734,922 Q2074L probably benign Het
Pthlh G A 6: 147,257,012 T150I probably benign Het
Ptprq A T 10: 107,705,553 Y371N probably damaging Het
Rfwd3 A G 8: 111,283,343 S377P probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sap130 T C 18: 31,677,479 probably null Het
Sap25 T G 5: 137,642,629 M229R possibly damaging Het
Scaper A T 9: 55,859,037 V479E probably null Het
Scn3a T A 2: 65,507,206 D649V probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Sowahb T C 5: 93,044,425 E145G possibly damaging Het
Stxbp5 T A 10: 9,835,846 I277F possibly damaging Het
Tanc1 T C 2: 59,843,833 S1754P possibly damaging Het
Tanc2 A G 11: 105,910,309 D1117G probably benign Het
Tbc1d31 A G 15: 57,951,741 M605V possibly damaging Het
Tekt3 A T 11: 63,094,688 D440V possibly damaging Het
Tmem67 C T 4: 12,063,730 W477* probably null Het
Tra2a T C 6: 49,250,927 probably benign Het
Trappc12 A G 12: 28,747,381 F51L possibly damaging Het
Trrap C A 5: 144,821,855 P2183Q probably benign Het
Ubn2 T A 6: 38,470,141 probably null Het
Unc5d A T 8: 28,694,540 V644E probably damaging Het
Xpo4 A G 14: 57,590,090 L883P probably damaging Het
Zbbx T G 3: 75,052,414 D616A possibly damaging Het
Zfp943 T A 17: 21,992,823 C297S probably damaging Het
Other mutations in Col6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Col6a4 APN 9 106022896 missense probably benign 0.00
IGL00691:Col6a4 APN 9 106057407 missense probably damaging 1.00
IGL01508:Col6a4 APN 9 106013605 missense possibly damaging 0.95
IGL01580:Col6a4 APN 9 106068198 missense probably damaging 1.00
IGL01610:Col6a4 APN 9 106047707 splice site probably benign
IGL01813:Col6a4 APN 9 106077253 missense probably damaging 1.00
IGL01933:Col6a4 APN 9 106060114 missense probably benign 0.04
IGL01973:Col6a4 APN 9 106062894 missense probably damaging 1.00
IGL02053:Col6a4 APN 9 106063095 missense possibly damaging 0.92
IGL02063:Col6a4 APN 9 106057418 missense probably benign 0.01
IGL02065:Col6a4 APN 9 106077103 missense probably damaging 0.99
IGL02106:Col6a4 APN 9 106063105 missense possibly damaging 0.95
IGL02220:Col6a4 APN 9 106062942 missense possibly damaging 0.91
IGL02228:Col6a4 APN 9 106068078 missense probably benign
IGL02234:Col6a4 APN 9 106013432 missense possibly damaging 0.92
IGL02294:Col6a4 APN 9 106066732 missense probably benign 0.04
IGL02314:Col6a4 APN 9 105997156 missense probably damaging 0.99
IGL03065:Col6a4 APN 9 106041164 splice site probably benign
IGL03086:Col6a4 APN 9 106082862 splice site probably benign
IGL03185:Col6a4 APN 9 106019454 missense probably damaging 0.97
R0092:Col6a4 UTSW 9 106013314 missense probably benign 0.04
R0095:Col6a4 UTSW 9 106075356 missense probably benign 0.03
R0230:Col6a4 UTSW 9 106072366 missense probably benign 0.11
R0359:Col6a4 UTSW 9 105997146 missense probably benign
R0415:Col6a4 UTSW 9 106075080 missense probably damaging 0.99
R0433:Col6a4 UTSW 9 106067994 missense probably damaging 0.99
R0450:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0469:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0490:Col6a4 UTSW 9 106013770 missense probably damaging 0.99
R0621:Col6a4 UTSW 9 106066791 missense probably damaging 0.97
R0667:Col6a4 UTSW 9 106029959 splice site probably benign
R0681:Col6a4 UTSW 9 106067144 nonsense probably null
R0690:Col6a4 UTSW 9 106028187 splice site probably benign
R0714:Col6a4 UTSW 9 106017903 unclassified probably benign
R0788:Col6a4 UTSW 9 106071998 missense probably benign 0.15
R1036:Col6a4 UTSW 9 106068198 missense probably damaging 1.00
R1296:Col6a4 UTSW 9 106062853 missense possibly damaging 0.47
R1386:Col6a4 UTSW 9 106062945 missense probably benign 0.15
R1484:Col6a4 UTSW 9 106013302 critical splice donor site probably null
R1528:Col6a4 UTSW 9 106075220 missense probably damaging 0.99
R1555:Col6a4 UTSW 9 106000886 missense possibly damaging 0.93
R1622:Col6a4 UTSW 9 105997135 missense probably benign 0.01
R1653:Col6a4 UTSW 9 106072409 missense probably damaging 0.99
R1720:Col6a4 UTSW 9 106026472 missense probably damaging 1.00
R1768:Col6a4 UTSW 9 106080100 missense probably benign
R1941:Col6a4 UTSW 9 106075010 missense probably benign 0.00
R2092:Col6a4 UTSW 9 106060331 missense probably damaging 1.00
R2134:Col6a4 UTSW 9 106066661 missense probably benign 0.09
R2149:Col6a4 UTSW 9 106076929 missense probably benign 0.00
R2204:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2248:Col6a4 UTSW 9 106079959 missense probably benign 0.15
R2568:Col6a4 UTSW 9 106063076 missense possibly damaging 0.90
R3750:Col6a4 UTSW 9 106020665 critical splice acceptor site probably null
R3751:Col6a4 UTSW 9 106072114 missense probably damaging 0.98
R3776:Col6a4 UTSW 9 106051701 nonsense probably null
R3872:Col6a4 UTSW 9 106013659 missense possibly damaging 0.95
R4043:Col6a4 UTSW 9 106072411 nonsense probably null
R4056:Col6a4 UTSW 9 106026466 missense probably damaging 0.98
R4212:Col6a4 UTSW 9 106075370 missense probably benign 0.28
R4417:Col6a4 UTSW 9 106072016 missense probably damaging 0.99
R4683:Col6a4 UTSW 9 106080130 missense probably benign 0.00
R4719:Col6a4 UTSW 9 106068252 missense probably damaging 0.99
R4791:Col6a4 UTSW 9 106080202 missense possibly damaging 0.68
R4833:Col6a4 UTSW 9 106071979 missense probably benign 0.00
R4886:Col6a4 UTSW 9 106060072 missense probably benign 0.00
R4998:Col6a4 UTSW 9 105990778 utr 3 prime probably benign
R5091:Col6a4 UTSW 9 106075063 missense probably damaging 1.00
R5113:Col6a4 UTSW 9 106066960 missense possibly damaging 0.89
R5129:Col6a4 UTSW 9 106013377 missense probably damaging 0.98
R5231:Col6a4 UTSW 9 106025531 missense probably damaging 0.96
R5297:Col6a4 UTSW 9 106074867 missense probably benign 0.02
R5352:Col6a4 UTSW 9 106061544 missense probably damaging 1.00
R5438:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5518:Col6a4 UTSW 9 106072188 missense possibly damaging 0.68
R5657:Col6a4 UTSW 9 106072198 missense probably damaging 0.99
R5660:Col6a4 UTSW 9 105996116 missense probably benign 0.01
R5662:Col6a4 UTSW 9 106068001 missense probably damaging 0.99
R5777:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5800:Col6a4 UTSW 9 106080275 missense probably damaging 0.99
R5929:Col6a4 UTSW 9 106063044 missense probably benign 0.15
R5999:Col6a4 UTSW 9 106067921 missense probably benign 0.11
R6243:Col6a4 UTSW 9 106013390 missense possibly damaging 0.95
R6285:Col6a4 UTSW 9 106074986 missense probably damaging 0.96
R6288:Col6a4 UTSW 9 106068263 missense probably damaging 0.99
R6361:Col6a4 UTSW 9 106066703 missense probably benign 0.28
R6485:Col6a4 UTSW 9 106076870 critical splice donor site probably null
R6490:Col6a4 UTSW 9 106074992 nonsense probably null
R6537:Col6a4 UTSW 9 106067954 missense possibly damaging 0.87
R6598:Col6a4 UTSW 9 106000412 missense probably damaging 0.99
R6643:Col6a4 UTSW 9 106000631 missense probably damaging 0.96
R6905:Col6a4 UTSW 9 106060318 splice site probably null
R6944:Col6a4 UTSW 9 106072171 missense probably damaging 0.98
R7015:Col6a4 UTSW 9 106033755 critical splice donor site probably null
R7027:Col6a4 UTSW 9 106067014 missense probably damaging 1.00
R7088:Col6a4 UTSW 9 106000686 missense possibly damaging 0.56
R7200:Col6a4 UTSW 9 106072249 missense possibly damaging 0.68
R7238:Col6a4 UTSW 9 106000320 missense probably damaging 0.99
R7273:Col6a4 UTSW 9 106000457 missense possibly damaging 0.92
R7335:Col6a4 UTSW 9 106076892 missense possibly damaging 0.90
R7418:Col6a4 UTSW 9 106022915 missense probably damaging 1.00
R7421:Col6a4 UTSW 9 106020795 missense probably damaging 0.99
R7530:Col6a4 UTSW 9 106068390 missense probably damaging 0.99
R7600:Col6a4 UTSW 9 106066999 missense possibly damaging 0.86
R7701:Col6a4 UTSW 9 106082888 missense probably benign 0.17
R7830:Col6a4 UTSW 9 106075390 missense probably damaging 0.99
R7881:Col6a4 UTSW 9 106080298 missense probably benign 0.14
R7964:Col6a4 UTSW 9 106080298 missense probably benign 0.14
RF022:Col6a4 UTSW 9 106077008 missense probably damaging 0.99
X0025:Col6a4 UTSW 9 106000455 missense probably damaging 0.99
Z1176:Col6a4 UTSW 9 106000797 missense probably benign
Z1176:Col6a4 UTSW 9 106000870 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGAAAGGTTTGCTAGGACTG -3'
(R):5'- GTGAGTCCTCTTCCAAAGCTTTG -3'

Sequencing Primer
(F):5'- CTGAAAGGTTTGCTAGGACTGTAGAG -3'
(R):5'- CCAAAGCTTTGTTTTTCACTTGG -3'
Posted On2014-10-02