Mutagenetix > Incidental Mutations

Incidental Mutation 'R2174:Col6a4'

237708

Institutional Source

Beutler Lab

Gene Symbol

Col6a4

Ensembl Gene

ENSMUSG00000032572

Gene Name

collagen, type VI, alpha 4

Synonyms

Vwa6, 1110001D15Rik, EG235580, Dvwa

MMRRC Submission

040176-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2174 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105989454-106096783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106060132 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1395 (D1395G)

Ref Sequence

ENSEMBL: ENSMUSP00000112472 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121963]

Predicted Effect

probably damaging
Transcript: ENSMUST00000121963
AA Change: D1395G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: D1395G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWA	32	211	2.44e-35	SMART
VWA	233	410	8.67e-50	SMART
VWA	428	604	2.74e-29	SMART
VWA	632	816	4.78e-20	SMART
VWA	847	1019	3.02e-40	SMART
VWA	1028	1204	3.17e-43	SMART
VWA	1210	1391	4.73e-1	SMART
low complexity region	1444	1462	N/A	INTRINSIC
PDB:3HR2\|B	1469	1593	3e-7	PDB
low complexity region	1594	1622	N/A	INTRINSIC
low complexity region	1625	1643	N/A	INTRINSIC
low complexity region	1649	1671	N/A	INTRINSIC
Pfam:Collagen	1684	1748	1.4e-9	PFAM
VWA	1774	1953	2.18e-14	SMART
VWA	1980	2174	1.89e-9	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

99% (73/74)

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C10Rik	T	C	7: 38,194,828	I95T	possibly damaging	Het
4930452B06Rik	T	C	14: 8,558,109	I159V	probably benign	Het
Adarb1	A	G	10: 77,295,798	I619T	probably benign	Het
Aldh2	T	C	5: 121,572,668		probably benign	Het
Antxrl	T	A	14: 34,060,400	L180Q	probably damaging	Het
Asnsd1	A	T	1: 53,347,601	I289N	probably benign	Het
Asxl3	T	G	18: 22,453,644	S164A	possibly damaging	Het
Cacnb2	C	T	2: 14,958,767	T108I	probably benign	Het
Capn2	A	T	1: 182,479,725	I516N	probably benign	Het
Casc1	T	C	6: 145,175,170	H641R	probably damaging	Het
Ccdc59	A	T	10: 105,841,527	K9M	possibly damaging	Het
Cenpo	T	C	12: 4,217,318	K73R	probably benign	Het
Clasp1	A	G	1: 118,560,095	H823R	probably damaging	Het
Ddx60	A	G	8: 61,956,141	I404V	probably damaging	Het
Ddx60	G	T	8: 62,017,200	M1407I	probably benign	Het
Dennd3	A	T	15: 73,555,305	R844W	probably damaging	Het
Depdc1b	A	T	13: 108,362,253	K157*	probably null	Het
Dnajc1	T	C	2: 18,307,951	D196G	probably damaging	Het
Fanca	A	G	8: 123,271,270	W1226R	probably benign	Het
Fbxl13	A	G	5: 21,582,048	V297A	possibly damaging	Het
Fnta	A	T	8: 26,013,470	F96I	possibly damaging	Het
Fzd3	T	C	14: 65,212,231		probably benign	Het
Gckr	T	C	5: 31,327,009	V597A	possibly damaging	Het
Gm43302	T	C	5: 105,274,350	K496R	probably benign	Het
Gm5283	A	G	3: 17,230,841		noncoding transcript	Het
Gm5724	A	T	6: 141,727,593	Y406*	probably null	Het
Gm6741	A	G	17: 91,236,904	I32V	probably benign	Het
Gnptab	T	A	10: 88,434,044	F870I	probably damaging	Het
Gpx8	G	A	13: 113,045,606	P98S	probably benign	Het
Grm2	T	C	9: 106,647,795	I574V	probably benign	Het
Gtf3c5	T	C	2: 28,567,775	D468G	probably benign	Het
Hectd3	A	T	4: 116,999,701	M482L	probably benign	Het
Ier5	G	T	1: 155,098,853	P193H	possibly damaging	Het
Inpp4a	A	G	1: 37,396,130	N827S	probably damaging	Het
Kif13a	A	G	13: 46,769,176	L387P	probably damaging	Het
Map3k1	G	C	13: 111,752,482	H1314D	possibly damaging	Het
Mbl2	G	A	19: 30,234,012	C11Y	possibly damaging	Het
Msr1	A	G	8: 39,631,340	L58P	probably damaging	Het
Mtmr10	T	A	7: 64,336,764	F530Y	possibly damaging	Het
Myo7b	A	G	18: 31,983,557	L999P	probably damaging	Het
Myoz3	T	C	18: 60,590,224	E8G	probably benign	Het
Naip6	C	A	13: 100,298,987	M1009I	probably benign	Het
Nav2	T	A	7: 49,452,663	M342K	probably damaging	Het
Ndufaf6	T	C	4: 11,070,228	H131R	probably benign	Het
Nlrp4a	T	C	7: 26,449,424	L152P	probably damaging	Het
Olfr1413	A	G	1: 92,573,657	N162S	probably benign	Het
Pan3	T	C	5: 147,450,653	I144T	possibly damaging	Het
Prkdc	A	T	16: 15,734,922	Q2074L	probably benign	Het
Pthlh	G	A	6: 147,257,012	T150I	probably benign	Het
Ptprq	A	T	10: 107,705,553	Y371N	probably damaging	Het
Rfwd3	A	G	8: 111,283,343	S377P	probably damaging	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Sap130	T	C	18: 31,677,479		probably null	Het
Sap25	T	G	5: 137,642,629	M229R	possibly damaging	Het
Scaper	A	T	9: 55,859,037	V479E	probably null	Het
Scn3a	T	A	2: 65,507,206	D649V	probably damaging	Het
Smc1b	A	G	15: 85,121,851		probably benign	Het
Sowahb	T	C	5: 93,044,425	E145G	possibly damaging	Het
Stxbp5	T	A	10: 9,835,846	I277F	possibly damaging	Het
Tanc1	T	C	2: 59,843,833	S1754P	possibly damaging	Het
Tanc2	A	G	11: 105,910,309	D1117G	probably benign	Het
Tbc1d31	A	G	15: 57,951,741	M605V	possibly damaging	Het
Tekt3	A	T	11: 63,094,688	D440V	possibly damaging	Het
Tmem67	C	T	4: 12,063,730	W477*	probably null	Het
Tra2a	T	C	6: 49,250,927		probably benign	Het
Trappc12	A	G	12: 28,747,381	F51L	possibly damaging	Het
Trrap	C	A	5: 144,821,855	P2183Q	probably benign	Het
Ubn2	T	A	6: 38,470,141		probably null	Het
Unc5d	A	T	8: 28,694,540	V644E	probably damaging	Het
Xpo4	A	G	14: 57,590,090	L883P	probably damaging	Het
Zbbx	T	G	3: 75,052,414	D616A	possibly damaging	Het
Zfp943	T	A	17: 21,992,823	C297S	probably damaging	Het

Other mutations in Col6a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00573:Col6a4	APN	9	106022896	missense	probably benign	0.00
IGL00691:Col6a4	APN	9	106057407	missense	probably damaging	1.00
IGL01508:Col6a4	APN	9	106013605	missense	possibly damaging	0.95
IGL01580:Col6a4	APN	9	106068198	missense	probably damaging	1.00
IGL01610:Col6a4	APN	9	106047707	splice site	probably benign
IGL01813:Col6a4	APN	9	106077253	missense	probably damaging	1.00
IGL01933:Col6a4	APN	9	106060114	missense	probably benign	0.04
IGL01973:Col6a4	APN	9	106062894	missense	probably damaging	1.00
IGL02053:Col6a4	APN	9	106063095	missense	possibly damaging	0.92
IGL02063:Col6a4	APN	9	106057418	missense	probably benign	0.01
IGL02065:Col6a4	APN	9	106077103	missense	probably damaging	0.99
IGL02106:Col6a4	APN	9	106063105	missense	possibly damaging	0.95
IGL02220:Col6a4	APN	9	106062942	missense	possibly damaging	0.91
IGL02228:Col6a4	APN	9	106068078	missense	probably benign
IGL02234:Col6a4	APN	9	106013432	missense	possibly damaging	0.92
IGL02294:Col6a4	APN	9	106066732	missense	probably benign	0.04
IGL02314:Col6a4	APN	9	105997156	missense	probably damaging	0.99
IGL03065:Col6a4	APN	9	106041164	splice site	probably benign
IGL03086:Col6a4	APN	9	106082862	splice site	probably benign
IGL03185:Col6a4	APN	9	106019454	missense	probably damaging	0.97
R0092:Col6a4	UTSW	9	106013314	missense	probably benign	0.04
R0095:Col6a4	UTSW	9	106075356	missense	probably benign	0.03
R0230:Col6a4	UTSW	9	106072366	missense	probably benign	0.11
R0359:Col6a4	UTSW	9	105997146	missense	probably benign
R0415:Col6a4	UTSW	9	106075080	missense	probably damaging	0.99
R0433:Col6a4	UTSW	9	106067994	missense	probably damaging	0.99
R0450:Col6a4	UTSW	9	106080547	missense	probably damaging	1.00
R0469:Col6a4	UTSW	9	106080547	missense	probably damaging	1.00
R0490:Col6a4	UTSW	9	106013770	missense	probably damaging	0.99
R0621:Col6a4	UTSW	9	106066791	missense	probably damaging	0.97
R0667:Col6a4	UTSW	9	106029959	splice site	probably benign
R0681:Col6a4	UTSW	9	106067144	nonsense	probably null
R0690:Col6a4	UTSW	9	106028187	splice site	probably benign
R0714:Col6a4	UTSW	9	106017903	unclassified	probably benign
R0788:Col6a4	UTSW	9	106071998	missense	probably benign	0.15
R1036:Col6a4	UTSW	9	106068198	missense	probably damaging	1.00
R1296:Col6a4	UTSW	9	106062853	missense	possibly damaging	0.47
R1386:Col6a4	UTSW	9	106062945	missense	probably benign	0.15
R1484:Col6a4	UTSW	9	106013302	critical splice donor site	probably null
R1528:Col6a4	UTSW	9	106075220	missense	probably damaging	0.99
R1555:Col6a4	UTSW	9	106000886	missense	possibly damaging	0.93
R1622:Col6a4	UTSW	9	105997135	missense	probably benign	0.01
R1653:Col6a4	UTSW	9	106072409	missense	probably damaging	0.99
R1720:Col6a4	UTSW	9	106026472	missense	probably damaging	1.00
R1768:Col6a4	UTSW	9	106080100	missense	probably benign
R1941:Col6a4	UTSW	9	106075010	missense	probably benign	0.00
R2092:Col6a4	UTSW	9	106060331	missense	probably damaging	1.00
R2134:Col6a4	UTSW	9	106066661	missense	probably benign	0.09
R2149:Col6a4	UTSW	9	106076929	missense	probably benign	0.00
R2204:Col6a4	UTSW	9	106060132	missense	probably damaging	0.98
R2248:Col6a4	UTSW	9	106079959	missense	probably benign	0.15
R2568:Col6a4	UTSW	9	106063076	missense	possibly damaging	0.90
R3750:Col6a4	UTSW	9	106020665	critical splice acceptor site	probably null
R3751:Col6a4	UTSW	9	106072114	missense	probably damaging	0.98
R3776:Col6a4	UTSW	9	106051701	nonsense	probably null
R3872:Col6a4	UTSW	9	106013659	missense	possibly damaging	0.95
R4043:Col6a4	UTSW	9	106072411	nonsense	probably null
R4056:Col6a4	UTSW	9	106026466	missense	probably damaging	0.98
R4212:Col6a4	UTSW	9	106075370	missense	probably benign	0.28
R4417:Col6a4	UTSW	9	106072016	missense	probably damaging	0.99
R4683:Col6a4	UTSW	9	106080130	missense	probably benign	0.00
R4719:Col6a4	UTSW	9	106068252	missense	probably damaging	0.99
R4791:Col6a4	UTSW	9	106080202	missense	possibly damaging	0.68
R4833:Col6a4	UTSW	9	106071979	missense	probably benign	0.00
R4886:Col6a4	UTSW	9	106060072	missense	probably benign	0.00
R4998:Col6a4	UTSW	9	105990778	utr 3 prime	probably benign
R5091:Col6a4	UTSW	9	106075063	missense	probably damaging	1.00
R5113:Col6a4	UTSW	9	106066960	missense	possibly damaging	0.89
R5129:Col6a4	UTSW	9	106013377	missense	probably damaging	0.98
R5231:Col6a4	UTSW	9	106025531	missense	probably damaging	0.96
R5297:Col6a4	UTSW	9	106074867	missense	probably benign	0.02
R5352:Col6a4	UTSW	9	106061544	missense	probably damaging	1.00
R5438:Col6a4	UTSW	9	106013696	missense	possibly damaging	0.95
R5518:Col6a4	UTSW	9	106072188	missense	possibly damaging	0.68
R5657:Col6a4	UTSW	9	106072198	missense	probably damaging	0.99
R5660:Col6a4	UTSW	9	105996116	missense	probably benign	0.01
R5662:Col6a4	UTSW	9	106068001	missense	probably damaging	0.99
R5777:Col6a4	UTSW	9	106013696	missense	possibly damaging	0.95
R5800:Col6a4	UTSW	9	106080275	missense	probably damaging	0.99
R5929:Col6a4	UTSW	9	106063044	missense	probably benign	0.15
R5999:Col6a4	UTSW	9	106067921	missense	probably benign	0.11
R6243:Col6a4	UTSW	9	106013390	missense	possibly damaging	0.95
R6285:Col6a4	UTSW	9	106074986	missense	probably damaging	0.96
R6288:Col6a4	UTSW	9	106068263	missense	probably damaging	0.99
R6361:Col6a4	UTSW	9	106066703	missense	probably benign	0.28
R6485:Col6a4	UTSW	9	106076870	critical splice donor site	probably null
R6490:Col6a4	UTSW	9	106074992	nonsense	probably null
R6537:Col6a4	UTSW	9	106067954	missense	possibly damaging	0.87
R6598:Col6a4	UTSW	9	106000412	missense	probably damaging	0.99
R6643:Col6a4	UTSW	9	106000631	missense	probably damaging	0.96
R6905:Col6a4	UTSW	9	106060318	splice site	probably null
R6944:Col6a4	UTSW	9	106072171	missense	probably damaging	0.98
R7015:Col6a4	UTSW	9	106033755	critical splice donor site	probably null
R7027:Col6a4	UTSW	9	106067014	missense	probably damaging	1.00
R7088:Col6a4	UTSW	9	106000686	missense	possibly damaging	0.56
R7200:Col6a4	UTSW	9	106072249	missense	possibly damaging	0.68
R7238:Col6a4	UTSW	9	106000320	missense	probably damaging	0.99
R7273:Col6a4	UTSW	9	106000457	missense	possibly damaging	0.92
R7335:Col6a4	UTSW	9	106076892	missense	possibly damaging	0.90
R7418:Col6a4	UTSW	9	106022915	missense	probably damaging	1.00
R7421:Col6a4	UTSW	9	106020795	missense	probably damaging	0.99
R7530:Col6a4	UTSW	9	106068390	missense	probably damaging	0.99
R7600:Col6a4	UTSW	9	106066999	missense	possibly damaging	0.86
R7701:Col6a4	UTSW	9	106082888	missense	probably benign	0.17
R7830:Col6a4	UTSW	9	106075390	missense	probably damaging	0.99
R7881:Col6a4	UTSW	9	106080298	missense	probably benign	0.14
R8157:Col6a4	UTSW	9	106067898	missense	possibly damaging	0.92
R8292:Col6a4	UTSW	9	106076877	missense	probably benign	0.01
R8309:Col6a4	UTSW	9	106075215	missense	probably benign	0.08
R8336:Col6a4	UTSW	9	106075329	missense	possibly damaging	0.65
R8359:Col6a4	UTSW	9	106068384	missense	probably benign	0.00
R8530:Col6a4	UTSW	9	106080505	missense	probably benign	0.31
R8556:Col6a4	UTSW	9	106067053	missense	probably damaging	0.96
RF022:Col6a4	UTSW	9	106077008	missense	probably damaging	0.99
X0025:Col6a4	UTSW	9	106000455	missense	probably damaging	0.99
Z1176:Col6a4	UTSW	9	106000797	missense	probably benign
Z1176:Col6a4	UTSW	9	106000870	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCTGAAAGGTTTGCTAGGACTG -3'
(R):5'- GTGAGTCCTCTTCCAAAGCTTTG -3'

Sequencing Primer
(F):5'- CTGAAAGGTTTGCTAGGACTGTAGAG -3'
(R):5'- CCAAAGCTTTGTTTTTCACTTGG -3'

Posted On

2014-10-02