Incidental Mutation 'R7238:Col6a4'
ID563003
Institutional Source Beutler Lab
Gene Symbol Col6a4
Ensembl Gene ENSMUSG00000032572
Gene Namecollagen, type VI, alpha 4
SynonymsVwa6, 1110001D15Rik, EG235580, Dvwa
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7238 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location105989454-106096783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106000320 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 2153 (V2153M)
Ref Sequence ENSEMBL: ENSMUSP00000112472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121963]
Predicted Effect probably damaging
Transcript: ENSMUST00000121963
AA Change: V2153M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: V2153M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWA 32 211 2.44e-35 SMART
VWA 233 410 8.67e-50 SMART
VWA 428 604 2.74e-29 SMART
VWA 632 816 4.78e-20 SMART
VWA 847 1019 3.02e-40 SMART
VWA 1028 1204 3.17e-43 SMART
VWA 1210 1391 4.73e-1 SMART
low complexity region 1444 1462 N/A INTRINSIC
PDB:3HR2|B 1469 1593 3e-7 PDB
low complexity region 1594 1622 N/A INTRINSIC
low complexity region 1625 1643 N/A INTRINSIC
low complexity region 1649 1671 N/A INTRINSIC
Pfam:Collagen 1684 1748 1.4e-9 PFAM
VWA 1774 1953 2.18e-14 SMART
VWA 1980 2174 1.89e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218471
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 97% (104/107)
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,069,951 T1634S probably damaging Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
4933402N22Rik T C 5: 11,920,745 I127T Het
5830473C10Rik A T 5: 90,579,660 Y379F probably damaging Het
Adgrl1 T A 8: 83,939,064 M1460K probably damaging Het
Adig T A 2: 158,505,853 L29Q unknown Het
Adnp T G 2: 168,183,967 K469N probably damaging Het
Akap3 A G 6: 126,865,237 D273G probably benign Het
Ankrd34b T C 13: 92,438,631 Y124H possibly damaging Het
Ap2b1 T G 11: 83,333,122 F221C possibly damaging Het
Atp2c2 A G 8: 119,742,421 I358V possibly damaging Het
BC051665 G A 13: 60,782,722 T272I probably benign Het
BC117090 C T 16: 36,321,831 G61D probably benign Het
Cdan1 G T 2: 120,730,302 A262E probably benign Het
Ces1d C T 8: 93,178,135 V326I probably benign Het
Chd3 T C 11: 69,364,047 R156G probably benign Het
Clip1 C T 5: 123,613,265 E818K Het
Crlf3 T C 11: 80,056,525 N296D possibly damaging Het
D130052B06Rik A G 11: 33,623,594 I109V probably benign Het
Dcaf5 G T 12: 80,338,709 T881K probably benign Het
Dennd4a C A 9: 64,861,956 T408K probably damaging Het
Dnah2 A G 11: 69,459,146 probably null Het
Eif2ak2 C T 17: 78,866,331 V273I probably benign Het
Elac1 C T 18: 73,739,288 G212D probably damaging Het
Ercc6l2 A G 13: 63,865,984 D623G probably damaging Het
Exo1 T C 1: 175,888,847 F177L probably damaging Het
Fat4 A G 3: 38,890,413 T1152A probably benign Het
Fbxl12 G T 9: 20,618,413 probably null Het
Fbxo43 T C 15: 36,151,825 Y582C probably damaging Het
Fsip2 T A 2: 82,982,140 N2934K possibly damaging Het
Gm4951 A G 18: 60,246,283 S297G possibly damaging Het
Gm8300 A T 12: 87,517,236 K114* probably null Het
Gna12 A G 5: 140,830,092 S69P probably damaging Het
Gpatch8 C A 11: 102,478,528 G1395C probably damaging Het
Gpr137c A G 14: 45,278,691 Y294C probably damaging Het
Greb1 A G 12: 16,674,672 S1834P probably damaging Het
Grin2b T C 6: 135,780,251 D404G probably damaging Het
Hectd2 A T 19: 36,597,078 N236I probably damaging Het
Hhip C T 8: 79,987,012 V562I probably benign Het
Hipk2 G T 6: 38,716,057 T867N probably benign Het
Hmgcl T C 4: 135,962,113 V294A possibly damaging Het
Hnrnpl T A 7: 28,813,975 F158I Het
Hspa5 T C 2: 34,772,371 V17A unknown Het
Hspg2 T C 4: 137,508,393 V168A probably damaging Het
Idh1 A G 1: 65,166,125 F227S probably damaging Het
Immp2l T C 12: 41,110,916 V71A possibly damaging Het
Iqce G A 5: 140,689,958 R193* probably null Het
Kcnq5 T C 1: 21,402,302 D907G probably benign Het
Krt17 T A 11: 100,257,787 T306S probably benign Het
Lhx3 T C 2: 26,202,997 D149G probably damaging Het
Lrrc73 G A 17: 46,254,562 R73H probably damaging Het
Mgat5b T C 11: 116,984,983 S678P probably benign Het
Mink1 T C 11: 70,611,479 probably null Het
Mroh5 T G 15: 73,791,429 probably null Het
Muc5ac T A 7: 141,809,517 H2188Q unknown Het
Muc5ac G C 7: 141,809,687 probably benign Het
Musk G A 4: 58,344,312 G305D probably benign Het
Mx1 A G 16: 97,448,296 I347T unknown Het
Mybbp1a G T 11: 72,443,512 V198F probably damaging Het
Mycbp2 A G 14: 103,156,297 S2943P probably damaging Het
Myo18a G A 11: 77,842,233 R1363K probably damaging Het
Nav3 T A 10: 109,853,324 D364V possibly damaging Het
Olfr127 T C 17: 37,904,437 L297S probably benign Het
Olfr178 T A 16: 58,889,889 E110D probably damaging Het
Olfr309 T C 7: 86,306,591 H174R probably damaging Het
Olfr341 T A 2: 36,479,714 N139Y possibly damaging Het
Olfr385 A T 11: 73,589,735 M1K probably null Het
Pecr T C 1: 72,259,433 D276G probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp1cb A T 5: 32,491,032 T320S probably benign Het
Ppp1r9a G T 6: 5,159,716 K1084N probably damaging Het
Prdm2 A G 4: 143,135,821 S300P probably benign Het
Prkg1 C T 19: 30,624,690 V389I probably damaging Het
Psg25 C T 7: 18,532,202 probably benign Het
Ptpn6 A G 6: 124,721,858 S498P possibly damaging Het
Pus3 A G 9: 35,566,669 H399R probably benign Het
Pus7 T C 5: 23,778,452 T6A probably benign Het
Rnf169 A G 7: 99,925,747 V547A probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,921 probably benign Het
Ryr1 C T 7: 29,095,382 D1194N probably benign Het
Scn5a T C 9: 119,491,544 M1490V possibly damaging Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Selenoo T A 15: 89,089,224 M39K probably benign Het
Sept8 T G 11: 53,536,692 V246G possibly damaging Het
Serpina3k T A 12: 104,343,108 N270K probably damaging Het
Setd5 G A 6: 113,121,130 R710H probably damaging Het
Sirt4 A T 5: 115,482,990 I41N possibly damaging Het
Slc26a9 T A 1: 131,758,818 Y425* probably null Het
Slc4a9 A G 18: 36,529,720 E176G probably benign Het
Spidr A T 16: 15,966,816 W463R probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmcc1 G A 6: 116,134,237 Q28* probably null Het
Tmem52b A G 6: 129,516,688 E88G probably damaging Het
Trpc7 A T 13: 56,826,897 I402K probably benign Het
Tshz3 T C 7: 36,770,097 Y504H probably damaging Het
Ttn T C 2: 76,712,205 E33479G possibly damaging Het
Ttn G A 2: 76,881,328 R8290C unknown Het
Urb1 T C 16: 90,752,115 D2235G possibly damaging Het
Usp10 T C 8: 119,941,544 F195L probably benign Het
Vmn1r31 A T 6: 58,472,873 F2L Het
Vmn2r109 C T 17: 20,541,074 V674M probably damaging Het
Vmn2r12 G A 5: 109,097,789 P26S possibly damaging Het
Vmn2r61 T A 7: 42,267,205 M414K possibly damaging Het
Yipf3 T C 17: 46,251,659 V330A probably benign Het
Zic4 A T 9: 91,379,397 H235L probably benign Het
Zxdc T A 6: 90,369,660 W16R unknown Het
Other mutations in Col6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Col6a4 APN 9 106022896 missense probably benign 0.00
IGL00691:Col6a4 APN 9 106057407 missense probably damaging 1.00
IGL01508:Col6a4 APN 9 106013605 missense possibly damaging 0.95
IGL01580:Col6a4 APN 9 106068198 missense probably damaging 1.00
IGL01610:Col6a4 APN 9 106047707 splice site probably benign
IGL01813:Col6a4 APN 9 106077253 missense probably damaging 1.00
IGL01933:Col6a4 APN 9 106060114 missense probably benign 0.04
IGL01973:Col6a4 APN 9 106062894 missense probably damaging 1.00
IGL02053:Col6a4 APN 9 106063095 missense possibly damaging 0.92
IGL02063:Col6a4 APN 9 106057418 missense probably benign 0.01
IGL02065:Col6a4 APN 9 106077103 missense probably damaging 0.99
IGL02106:Col6a4 APN 9 106063105 missense possibly damaging 0.95
IGL02220:Col6a4 APN 9 106062942 missense possibly damaging 0.91
IGL02228:Col6a4 APN 9 106068078 missense probably benign
IGL02234:Col6a4 APN 9 106013432 missense possibly damaging 0.92
IGL02294:Col6a4 APN 9 106066732 missense probably benign 0.04
IGL02314:Col6a4 APN 9 105997156 missense probably damaging 0.99
IGL03065:Col6a4 APN 9 106041164 splice site probably benign
IGL03086:Col6a4 APN 9 106082862 splice site probably benign
IGL03185:Col6a4 APN 9 106019454 missense probably damaging 0.97
R0092:Col6a4 UTSW 9 106013314 missense probably benign 0.04
R0095:Col6a4 UTSW 9 106075356 missense probably benign 0.03
R0230:Col6a4 UTSW 9 106072366 missense probably benign 0.11
R0359:Col6a4 UTSW 9 105997146 missense probably benign
R0415:Col6a4 UTSW 9 106075080 missense probably damaging 0.99
R0433:Col6a4 UTSW 9 106067994 missense probably damaging 0.99
R0450:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0469:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0490:Col6a4 UTSW 9 106013770 missense probably damaging 0.99
R0621:Col6a4 UTSW 9 106066791 missense probably damaging 0.97
R0667:Col6a4 UTSW 9 106029959 splice site probably benign
R0681:Col6a4 UTSW 9 106067144 nonsense probably null
R0690:Col6a4 UTSW 9 106028187 splice site probably benign
R0714:Col6a4 UTSW 9 106017903 unclassified probably benign
R0788:Col6a4 UTSW 9 106071998 missense probably benign 0.15
R1036:Col6a4 UTSW 9 106068198 missense probably damaging 1.00
R1296:Col6a4 UTSW 9 106062853 missense possibly damaging 0.47
R1386:Col6a4 UTSW 9 106062945 missense probably benign 0.15
R1484:Col6a4 UTSW 9 106013302 critical splice donor site probably null
R1528:Col6a4 UTSW 9 106075220 missense probably damaging 0.99
R1555:Col6a4 UTSW 9 106000886 missense possibly damaging 0.93
R1622:Col6a4 UTSW 9 105997135 missense probably benign 0.01
R1653:Col6a4 UTSW 9 106072409 missense probably damaging 0.99
R1720:Col6a4 UTSW 9 106026472 missense probably damaging 1.00
R1768:Col6a4 UTSW 9 106080100 missense probably benign
R1941:Col6a4 UTSW 9 106075010 missense probably benign 0.00
R2092:Col6a4 UTSW 9 106060331 missense probably damaging 1.00
R2134:Col6a4 UTSW 9 106066661 missense probably benign 0.09
R2149:Col6a4 UTSW 9 106076929 missense probably benign 0.00
R2174:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2204:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2248:Col6a4 UTSW 9 106079959 missense probably benign 0.15
R2568:Col6a4 UTSW 9 106063076 missense possibly damaging 0.90
R3750:Col6a4 UTSW 9 106020665 critical splice acceptor site probably null
R3751:Col6a4 UTSW 9 106072114 missense probably damaging 0.98
R3776:Col6a4 UTSW 9 106051701 nonsense probably null
R3872:Col6a4 UTSW 9 106013659 missense possibly damaging 0.95
R4043:Col6a4 UTSW 9 106072411 nonsense probably null
R4056:Col6a4 UTSW 9 106026466 missense probably damaging 0.98
R4212:Col6a4 UTSW 9 106075370 missense probably benign 0.28
R4417:Col6a4 UTSW 9 106072016 missense probably damaging 0.99
R4683:Col6a4 UTSW 9 106080130 missense probably benign 0.00
R4719:Col6a4 UTSW 9 106068252 missense probably damaging 0.99
R4791:Col6a4 UTSW 9 106080202 missense possibly damaging 0.68
R4833:Col6a4 UTSW 9 106071979 missense probably benign 0.00
R4886:Col6a4 UTSW 9 106060072 missense probably benign 0.00
R4998:Col6a4 UTSW 9 105990778 utr 3 prime probably benign
R5091:Col6a4 UTSW 9 106075063 missense probably damaging 1.00
R5113:Col6a4 UTSW 9 106066960 missense possibly damaging 0.89
R5129:Col6a4 UTSW 9 106013377 missense probably damaging 0.98
R5231:Col6a4 UTSW 9 106025531 missense probably damaging 0.96
R5297:Col6a4 UTSW 9 106074867 missense probably benign 0.02
R5352:Col6a4 UTSW 9 106061544 missense probably damaging 1.00
R5438:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5518:Col6a4 UTSW 9 106072188 missense possibly damaging 0.68
R5657:Col6a4 UTSW 9 106072198 missense probably damaging 0.99
R5660:Col6a4 UTSW 9 105996116 missense probably benign 0.01
R5662:Col6a4 UTSW 9 106068001 missense probably damaging 0.99
R5777:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5800:Col6a4 UTSW 9 106080275 missense probably damaging 0.99
R5929:Col6a4 UTSW 9 106063044 missense probably benign 0.15
R5999:Col6a4 UTSW 9 106067921 missense probably benign 0.11
R6243:Col6a4 UTSW 9 106013390 missense possibly damaging 0.95
R6285:Col6a4 UTSW 9 106074986 missense probably damaging 0.96
R6288:Col6a4 UTSW 9 106068263 missense probably damaging 0.99
R6361:Col6a4 UTSW 9 106066703 missense probably benign 0.28
R6485:Col6a4 UTSW 9 106076870 critical splice donor site probably null
R6490:Col6a4 UTSW 9 106074992 nonsense probably null
R6537:Col6a4 UTSW 9 106067954 missense possibly damaging 0.87
R6598:Col6a4 UTSW 9 106000412 missense probably damaging 0.99
R6643:Col6a4 UTSW 9 106000631 missense probably damaging 0.96
R6905:Col6a4 UTSW 9 106060318 splice site probably null
R6944:Col6a4 UTSW 9 106072171 missense probably damaging 0.98
R7015:Col6a4 UTSW 9 106033755 critical splice donor site probably null
R7027:Col6a4 UTSW 9 106067014 missense probably damaging 1.00
R7088:Col6a4 UTSW 9 106000686 missense possibly damaging 0.56
R7200:Col6a4 UTSW 9 106072249 missense possibly damaging 0.68
R7273:Col6a4 UTSW 9 106000457 missense possibly damaging 0.92
R7335:Col6a4 UTSW 9 106076892 missense possibly damaging 0.90
R7418:Col6a4 UTSW 9 106022915 missense probably damaging 1.00
R7421:Col6a4 UTSW 9 106020795 missense probably damaging 0.99
R7530:Col6a4 UTSW 9 106068390 missense probably damaging 0.99
R7600:Col6a4 UTSW 9 106066999 missense possibly damaging 0.86
R7701:Col6a4 UTSW 9 106082888 missense probably benign 0.17
R7830:Col6a4 UTSW 9 106075390 missense probably damaging 0.99
R7881:Col6a4 UTSW 9 106080298 missense probably benign 0.14
R7964:Col6a4 UTSW 9 106080298 missense probably benign 0.14
R8157:Col6a4 UTSW 9 106067898 missense possibly damaging 0.92
R8292:Col6a4 UTSW 9 106076877 missense probably benign 0.01
R8309:Col6a4 UTSW 9 106075215 missense probably benign 0.08
RF022:Col6a4 UTSW 9 106077008 missense probably damaging 0.99
X0025:Col6a4 UTSW 9 106000455 missense probably damaging 0.99
Z1176:Col6a4 UTSW 9 106000797 missense probably benign
Z1176:Col6a4 UTSW 9 106000870 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACCTAGGATAACCCAGTC -3'
(R):5'- AAGCCCCTGTGCTTGAGTAC -3'

Sequencing Primer
(F):5'- TAGGATAACCCAGTCCCTACC -3'
(R):5'- CTGGAAAACGTGCTTCTGAC -3'
Posted On2019-06-26