Incidental Mutation 'R8309:Col6a4'
ID641277
Institutional Source Beutler Lab
Gene Symbol Col6a4
Ensembl Gene ENSMUSG00000032572
Gene Namecollagen, type VI, alpha 4
SynonymsVwa6, 1110001D15Rik, EG235580, Dvwa
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8309 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location105989454-106096783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106075215 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 495 (A495T)
Ref Sequence ENSEMBL: ENSMUSP00000112472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121963]
Predicted Effect probably benign
Transcript: ENSMUST00000121963
AA Change: A495T

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: A495T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWA 32 211 2.44e-35 SMART
VWA 233 410 8.67e-50 SMART
VWA 428 604 2.74e-29 SMART
VWA 632 816 4.78e-20 SMART
VWA 847 1019 3.02e-40 SMART
VWA 1028 1204 3.17e-43 SMART
VWA 1210 1391 4.73e-1 SMART
low complexity region 1444 1462 N/A INTRINSIC
PDB:3HR2|B 1469 1593 3e-7 PDB
low complexity region 1594 1622 N/A INTRINSIC
low complexity region 1625 1643 N/A INTRINSIC
low complexity region 1649 1671 N/A INTRINSIC
Pfam:Collagen 1684 1748 1.4e-9 PFAM
VWA 1774 1953 2.18e-14 SMART
VWA 1980 2174 1.89e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T A 2: 35,389,587 Y34F possibly damaging Het
Abcb6 A T 1: 75,172,944 S664T probably benign Het
Abcc4 C T 14: 118,616,392 V443M probably damaging Het
Abhd2 G A 7: 79,348,347 G209D probably damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Apbb2 T A 5: 66,362,836 M449L probably benign Het
Ccdc81 T A 7: 89,877,578 probably null Het
Cd209b A T 8: 3,926,559 C42* probably null Het
Cirh1a A T 8: 106,916,221 T504S probably benign Het
Clec18a A T 8: 111,082,057 M11K probably benign Het
Clock A T 5: 76,254,422 S130R probably benign Het
Col12a1 G A 9: 79,605,183 A2910V possibly damaging Het
Cyp4f37 A T 17: 32,634,978 N467I probably damaging Het
Ddo G A 10: 40,637,379 V106M possibly damaging Het
Dennd5a A G 7: 109,901,125 L931P probably damaging Het
Dgcr6 A G 16: 18,066,734 D82G probably damaging Het
Dnah7b T C 1: 46,139,872 S902P probably damaging Het
Dnal4 T G 15: 79,762,510 I57L probably benign Het
Dst T A 1: 34,117,511 I174N probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Efhb T C 17: 53,449,535 T363A probably damaging Het
Ehbp1l1 A G 19: 5,717,075 F1245S probably damaging Het
Eif4g1 A G 16: 20,688,828 D1453G probably benign Het
Fam102b G A 3: 109,027,342 probably benign Het
Fbp1 T C 13: 62,869,017 I224V probably benign Het
Gm10782 T G 13: 56,363,135 F79V noncoding transcript Het
Gm281 G A 14: 13,814,954 Q860* probably null Het
Gm498 A G 7: 143,883,943 N126S possibly damaging Het
Gpaa1 C G 15: 76,331,960 R47G possibly damaging Het
Hs2st1 G A 3: 144,437,604 S226L possibly damaging Het
Hydin A G 8: 110,607,902 Y4992C probably benign Het
Ikbke A T 1: 131,263,328 C549* probably null Het
Insrr G A 3: 87,810,442 G817S probably benign Het
Itgb5 G A 16: 33,865,553 V88I probably benign Het
Krt78 A G 15: 101,946,487 V963A probably benign Het
Lars T C 18: 42,243,028 Y239C possibly damaging Het
Map2k5 A G 9: 63,339,079 probably null Het
Mfn2 A T 4: 147,890,236 W118R probably benign Het
Mga T A 2: 119,960,930 I2550N probably damaging Het
Mgam A G 6: 40,745,177 I401V possibly damaging Het
Mrps18c A G 5: 100,804,398 Y141C probably damaging Het
Myo1e A T 9: 70,346,763 I565L possibly damaging Het
Nfatc4 G A 14: 55,826,391 E112K probably damaging Het
Nubp1 A G 16: 10,421,622 M255V probably benign Het
Olfr622 A G 7: 103,639,451 S230P probably damaging Het
Olfr702 A C 7: 106,824,413 S38A probably benign Het
Olfr952 C T 9: 39,426,670 V134I probably benign Het
Pask A T 1: 93,312,851 C1264* probably null Het
Pcgf2 T C 11: 97,691,743 T173A probably benign Het
Plcg1 T C 2: 160,753,933 I574T probably benign Het
Plin4 T C 17: 56,104,437 T865A probably damaging Het
Pnpt1 T C 11: 29,153,277 V514A probably benign Het
Ppp1r3a T A 6: 14,719,701 I405F probably benign Het
Qpctl A G 7: 19,148,473 V86A probably benign Het
Rab3gap1 G T 1: 127,909,918 W239L possibly damaging Het
Ralgapa2 T A 2: 146,404,866 T939S possibly damaging Het
Rapgef2 G T 3: 79,083,202 T923N possibly damaging Het
Rit2 T A 18: 31,153,845 I96F probably damaging Het
Rnase13 A T 14: 51,922,436 I82N probably damaging Het
Rp1 C A 1: 4,347,089 V1267L probably benign Het
Serpinb9b G A 13: 33,039,571 E249K probably damaging Het
Serpinb9c G T 13: 33,150,111 T344K possibly damaging Het
Serpinh1 T C 7: 99,348,944 I160V possibly damaging Het
Sipa1 A G 19: 5,654,936 S544P probably damaging Het
Slc17a5 A T 9: 78,571,029 Y231* probably null Het
Srcap T C 7: 127,549,357 V1959A probably damaging Het
Srrm4 G A 5: 116,591,567 probably benign Het
Stat1 T C 1: 52,151,245 I553T possibly damaging Het
Stpg1 A G 4: 135,529,592 I231M probably benign Het
Szt2 G GC 4: 118,375,482 probably null Het
Trpv3 C T 11: 73,279,921 T209M probably damaging Het
Tsc22d2 G T 3: 58,417,123 G479C unknown Het
Ttc3 A G 16: 94,466,979 H1950R probably damaging Het
Tusc3 A G 8: 39,164,841 *348W probably null Het
Vmn1r15 A G 6: 57,258,650 M168V probably benign Het
Wdr34 A G 2: 30,032,189 L420P probably damaging Het
Wdr60 T C 12: 116,256,085 E79G probably damaging Het
Xrcc5 T A 1: 72,319,127 M207K possibly damaging Het
Zdbf2 T A 1: 63,306,591 N1376K possibly damaging Het
Zfp558 A C 9: 18,456,917 S192A probably benign Het
Zfp964 A G 8: 69,663,274 T175A possibly damaging Het
Zfp988 A G 4: 147,332,308 R400G probably damaging Het
Other mutations in Col6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Col6a4 APN 9 106022896 missense probably benign 0.00
IGL00691:Col6a4 APN 9 106057407 missense probably damaging 1.00
IGL01508:Col6a4 APN 9 106013605 missense possibly damaging 0.95
IGL01580:Col6a4 APN 9 106068198 missense probably damaging 1.00
IGL01610:Col6a4 APN 9 106047707 splice site probably benign
IGL01813:Col6a4 APN 9 106077253 missense probably damaging 1.00
IGL01933:Col6a4 APN 9 106060114 missense probably benign 0.04
IGL01973:Col6a4 APN 9 106062894 missense probably damaging 1.00
IGL02053:Col6a4 APN 9 106063095 missense possibly damaging 0.92
IGL02063:Col6a4 APN 9 106057418 missense probably benign 0.01
IGL02065:Col6a4 APN 9 106077103 missense probably damaging 0.99
IGL02106:Col6a4 APN 9 106063105 missense possibly damaging 0.95
IGL02220:Col6a4 APN 9 106062942 missense possibly damaging 0.91
IGL02228:Col6a4 APN 9 106068078 missense probably benign
IGL02234:Col6a4 APN 9 106013432 missense possibly damaging 0.92
IGL02294:Col6a4 APN 9 106066732 missense probably benign 0.04
IGL02314:Col6a4 APN 9 105997156 missense probably damaging 0.99
IGL03065:Col6a4 APN 9 106041164 splice site probably benign
IGL03086:Col6a4 APN 9 106082862 splice site probably benign
IGL03185:Col6a4 APN 9 106019454 missense probably damaging 0.97
R0092:Col6a4 UTSW 9 106013314 missense probably benign 0.04
R0095:Col6a4 UTSW 9 106075356 missense probably benign 0.03
R0230:Col6a4 UTSW 9 106072366 missense probably benign 0.11
R0359:Col6a4 UTSW 9 105997146 missense probably benign
R0415:Col6a4 UTSW 9 106075080 missense probably damaging 0.99
R0433:Col6a4 UTSW 9 106067994 missense probably damaging 0.99
R0450:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0469:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0490:Col6a4 UTSW 9 106013770 missense probably damaging 0.99
R0621:Col6a4 UTSW 9 106066791 missense probably damaging 0.97
R0667:Col6a4 UTSW 9 106029959 splice site probably benign
R0681:Col6a4 UTSW 9 106067144 nonsense probably null
R0690:Col6a4 UTSW 9 106028187 splice site probably benign
R0714:Col6a4 UTSW 9 106017903 unclassified probably benign
R0788:Col6a4 UTSW 9 106071998 missense probably benign 0.15
R1036:Col6a4 UTSW 9 106068198 missense probably damaging 1.00
R1296:Col6a4 UTSW 9 106062853 missense possibly damaging 0.47
R1386:Col6a4 UTSW 9 106062945 missense probably benign 0.15
R1484:Col6a4 UTSW 9 106013302 critical splice donor site probably null
R1528:Col6a4 UTSW 9 106075220 missense probably damaging 0.99
R1555:Col6a4 UTSW 9 106000886 missense possibly damaging 0.93
R1622:Col6a4 UTSW 9 105997135 missense probably benign 0.01
R1653:Col6a4 UTSW 9 106072409 missense probably damaging 0.99
R1720:Col6a4 UTSW 9 106026472 missense probably damaging 1.00
R1768:Col6a4 UTSW 9 106080100 missense probably benign
R1941:Col6a4 UTSW 9 106075010 missense probably benign 0.00
R2092:Col6a4 UTSW 9 106060331 missense probably damaging 1.00
R2134:Col6a4 UTSW 9 106066661 missense probably benign 0.09
R2149:Col6a4 UTSW 9 106076929 missense probably benign 0.00
R2174:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2204:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2248:Col6a4 UTSW 9 106079959 missense probably benign 0.15
R2568:Col6a4 UTSW 9 106063076 missense possibly damaging 0.90
R3750:Col6a4 UTSW 9 106020665 critical splice acceptor site probably null
R3751:Col6a4 UTSW 9 106072114 missense probably damaging 0.98
R3776:Col6a4 UTSW 9 106051701 nonsense probably null
R3872:Col6a4 UTSW 9 106013659 missense possibly damaging 0.95
R4043:Col6a4 UTSW 9 106072411 nonsense probably null
R4056:Col6a4 UTSW 9 106026466 missense probably damaging 0.98
R4212:Col6a4 UTSW 9 106075370 missense probably benign 0.28
R4417:Col6a4 UTSW 9 106072016 missense probably damaging 0.99
R4683:Col6a4 UTSW 9 106080130 missense probably benign 0.00
R4719:Col6a4 UTSW 9 106068252 missense probably damaging 0.99
R4791:Col6a4 UTSW 9 106080202 missense possibly damaging 0.68
R4833:Col6a4 UTSW 9 106071979 missense probably benign 0.00
R4886:Col6a4 UTSW 9 106060072 missense probably benign 0.00
R4998:Col6a4 UTSW 9 105990778 utr 3 prime probably benign
R5091:Col6a4 UTSW 9 106075063 missense probably damaging 1.00
R5113:Col6a4 UTSW 9 106066960 missense possibly damaging 0.89
R5129:Col6a4 UTSW 9 106013377 missense probably damaging 0.98
R5231:Col6a4 UTSW 9 106025531 missense probably damaging 0.96
R5297:Col6a4 UTSW 9 106074867 missense probably benign 0.02
R5352:Col6a4 UTSW 9 106061544 missense probably damaging 1.00
R5438:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5518:Col6a4 UTSW 9 106072188 missense possibly damaging 0.68
R5657:Col6a4 UTSW 9 106072198 missense probably damaging 0.99
R5660:Col6a4 UTSW 9 105996116 missense probably benign 0.01
R5662:Col6a4 UTSW 9 106068001 missense probably damaging 0.99
R5777:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5800:Col6a4 UTSW 9 106080275 missense probably damaging 0.99
R5929:Col6a4 UTSW 9 106063044 missense probably benign 0.15
R5999:Col6a4 UTSW 9 106067921 missense probably benign 0.11
R6243:Col6a4 UTSW 9 106013390 missense possibly damaging 0.95
R6285:Col6a4 UTSW 9 106074986 missense probably damaging 0.96
R6288:Col6a4 UTSW 9 106068263 missense probably damaging 0.99
R6361:Col6a4 UTSW 9 106066703 missense probably benign 0.28
R6485:Col6a4 UTSW 9 106076870 critical splice donor site probably null
R6490:Col6a4 UTSW 9 106074992 nonsense probably null
R6537:Col6a4 UTSW 9 106067954 missense possibly damaging 0.87
R6598:Col6a4 UTSW 9 106000412 missense probably damaging 0.99
R6643:Col6a4 UTSW 9 106000631 missense probably damaging 0.96
R6905:Col6a4 UTSW 9 106060318 splice site probably null
R6944:Col6a4 UTSW 9 106072171 missense probably damaging 0.98
R7015:Col6a4 UTSW 9 106033755 critical splice donor site probably null
R7027:Col6a4 UTSW 9 106067014 missense probably damaging 1.00
R7088:Col6a4 UTSW 9 106000686 missense possibly damaging 0.56
R7200:Col6a4 UTSW 9 106072249 missense possibly damaging 0.68
R7238:Col6a4 UTSW 9 106000320 missense probably damaging 0.99
R7273:Col6a4 UTSW 9 106000457 missense possibly damaging 0.92
R7335:Col6a4 UTSW 9 106076892 missense possibly damaging 0.90
R7418:Col6a4 UTSW 9 106022915 missense probably damaging 1.00
R7421:Col6a4 UTSW 9 106020795 missense probably damaging 0.99
R7530:Col6a4 UTSW 9 106068390 missense probably damaging 0.99
R7600:Col6a4 UTSW 9 106066999 missense possibly damaging 0.86
R7701:Col6a4 UTSW 9 106082888 missense probably benign 0.17
R7830:Col6a4 UTSW 9 106075390 missense probably damaging 0.99
R7881:Col6a4 UTSW 9 106080298 missense probably benign 0.14
R8157:Col6a4 UTSW 9 106067898 missense possibly damaging 0.92
R8292:Col6a4 UTSW 9 106076877 missense probably benign 0.01
R8336:Col6a4 UTSW 9 106075329 missense possibly damaging 0.65
R8359:Col6a4 UTSW 9 106068384 missense probably benign 0.00
RF022:Col6a4 UTSW 9 106077008 missense probably damaging 0.99
X0025:Col6a4 UTSW 9 106000455 missense probably damaging 0.99
Z1176:Col6a4 UTSW 9 106000797 missense probably benign
Z1176:Col6a4 UTSW 9 106000870 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTTCCTCAGGATCTGTGCGAC -3'
(R):5'- GTCTACCAAGACCTACGCAG -3'

Sequencing Primer
(F):5'- AGGATCTGTGCGACCTCTC -3'
(R):5'- TTATTGACACCTCCCAGGGGAC -3'
Posted On2020-07-28