Mutagenetix > Incidental Mutation

Incidental Mutation 'R6944:Col6a4'

540779

Institutional Source

Beutler Lab

Gene Symbol

Col6a4

Ensembl Gene

ENSMUSG00000032572

Gene Name

collagen, type VI, alpha 4

Synonyms

Vwa6, 1110001D15Rik, EG235580, Dvwa

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6944 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105989454-106096783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106072171 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 755 (V755A)

Ref Sequence

ENSEMBL: ENSMUSP00000112472 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121963]

AlphaFold

A2AX52

Predicted Effect

probably damaging
Transcript: ENSMUST00000121963
AA Change: V755A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: V755A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWA	32	211	2.44e-35	SMART
VWA	233	410	8.67e-50	SMART
VWA	428	604	2.74e-29	SMART
VWA	632	816	4.78e-20	SMART
VWA	847	1019	3.02e-40	SMART
VWA	1028	1204	3.17e-43	SMART
VWA	1210	1391	4.73e-1	SMART
low complexity region	1444	1462	N/A	INTRINSIC
PDB:3HR2\|B	1469	1593	3e-7	PDB
low complexity region	1594	1622	N/A	INTRINSIC
low complexity region	1625	1643	N/A	INTRINSIC
low complexity region	1649	1671	N/A	INTRINSIC
Pfam:Collagen	1684	1748	1.4e-9	PFAM
VWA	1774	1953	2.18e-14	SMART
VWA	1980	2174	1.89e-9	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

97% (75/77)

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	A	C	10: 82,296,222	I318R	probably benign	Het
Abcb1b	T	G	5: 8,813,693	V216G	probably damaging	Het
Abcb5	T	C	12: 118,911,530	R636G	probably benign	Het
Ago1	G	T	4: 126,460,422	F198L	possibly damaging	Het
Ankrd42	C	T	7: 92,619,547		probably null	Het
Anxa11	T	A	14: 25,874,752	F274I	probably damaging	Het
Ascc1	T	C	10: 60,013,653	L122P	probably damaging	Het
Bptf	T	C	11: 107,080,823	S953G	probably damaging	Het
Chml	T	A	1: 175,688,161	N65Y	probably damaging	Het
Clcc1	A	G	3: 108,670,968	K262E	probably damaging	Het
Clhc1	T	G	11: 29,569,346	D384E	probably damaging	Het
Cnot2	G	A	10: 116,537,223		probably benign	Het
Cntnap1	T	C	11: 101,182,904	V627A	probably damaging	Het
Cyp4f18	T	A	8: 71,989,894	I406F	probably benign	Het
Dclre1a	T	C	19: 56,545,019	E381G	possibly damaging	Het
Dnah1	A	G	14: 31,268,904	Y3153H	probably damaging	Het
Dnah8	C	A	17: 30,794,659	D3791E	probably benign	Het
Dnah9	T	C	11: 66,085,149	E1358G	possibly damaging	Het
Eef1g	G	A	19: 8,968,292	R30H	probably benign	Het
Egln3	A	T	12: 54,183,952	I181N	probably benign	Het
Entpd6	A	G	2: 150,763,599	T250A	probably damaging	Het
Epb41l5	C	T	1: 119,609,129	R344Q	probably damaging	Het
Fam20b	T	C	1: 156,687,521	D258G	probably benign	Het
Fbxw18	A	T	9: 109,702,587	D21E	probably damaging	Het
Fbxw21	T	C	9: 109,157,535	E92G	probably damaging	Het
Fzd6	T	A	15: 39,025,817	M110K	possibly damaging	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Gm9268	T	C	7: 43,047,969	F817L	possibly damaging	Het
Golgb1	C	T	16: 36,912,113	P574L	probably benign	Het
Gpr153	A	G	4: 152,279,363	E80G	probably damaging	Het
Kcnt1	T	C	2: 25,877,828		probably benign	Het
Kcnt2	T	G	1: 140,584,065	V962G	probably benign	Het
Malt1	T	C	18: 65,437,920	V109A	probably benign	Het
March7	A	G	2: 60,234,243	I288V	probably benign	Het
Mief1	C	T	15: 80,249,443	R234C	probably damaging	Het
Morc3	A	G	16: 93,870,572	S613G	probably benign	Het
Myt1	A	G	2: 181,797,594	E345G	possibly damaging	Het
Napb	T	C	2: 148,706,969	T133A	probably benign	Het
Nwd1	T	C	8: 72,653,534	V16A	possibly damaging	Het
Oas1f	G	A	5: 120,848,184	E67K	probably benign	Het
Obscn	T	C	11: 59,038,930	K5153R	probably damaging	Het
Olfr1441	G	T	19: 12,423,264	M318I	probably benign	Het
Olfr154	C	T	2: 85,663,851	M194I	probably benign	Het
Olfr212	T	C	6: 116,515,830	F18L	possibly damaging	Het
Olfr317	T	A	11: 58,732,242	S308C	possibly damaging	Het
Pdcd2	T	C	17: 15,525,370	N185S	possibly damaging	Het
Pgap1	A	T	1: 54,530,161	W349R	probably damaging	Het
Prpf39	T	A	12: 65,042,680	V64E	probably benign	Het
Ptpn13	T	A	5: 103,476,991	W54R	probably null	Het
Rbms3	G	T	9: 117,110,105	P29Q	probably damaging	Het
Rnf123	A	G	9: 108,063,623	L679P	probably benign	Het
Samd4	T	A	14: 47,016,635	D84E	possibly damaging	Het
Scarf1	T	C	11: 75,522,206	V426A	probably benign	Het
Slc12a1	A	G	2: 125,160,534	N145D	probably damaging	Het
Slc2a6	A	T	2: 27,026,064	M99K	probably damaging	Het
Slc34a2	A	T	5: 53,064,883	I306L	probably benign	Het
Slx4ip	A	G	2: 137,068,275	K397E	probably damaging	Het
Smr3a	C	T	5: 88,008,090		probably benign	Het
Spef2	T	C	15: 9,592,749	E1502G	probably damaging	Het
Sri	A	T	5: 8,063,365	T119S	probably benign	Het
Synrg	T	A	11: 84,025,086	L1085H	probably damaging	Het
Taf7	A	T	18: 37,642,857	L219H	probably damaging	Het
Tmco3	T	A	8: 13,303,729	V347E	probably damaging	Het
Tmem8b	A	T	4: 43,674,465	I250F	probably damaging	Het
Tom1l2	A	G	11: 60,248,991	V239A	probably damaging	Het
Trpm1	T	A	7: 64,243,433	M1011K	probably damaging	Het
Tspan9	A	T	6: 127,965,806	Y153N	probably benign	Het
Ttll11	T	C	2: 35,752,294	H675R	probably benign	Het
Unc50	C	T	1: 37,432,662	T131M	probably damaging	Het
Vgf	T	A	5: 137,032,352	I456N	probably damaging	Het
Vmn1r223	A	G	13: 23,249,313	I26V	unknown	Het
Vmn1r39	T	C	6: 66,805,221	M1V	probably null	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r14	T	C	5: 109,216,059	T664A	probably benign	Het
Vmn2r14	G	A	5: 109,216,274	T592I	probably benign	Het
Vmn2r96	T	A	17: 18,597,629	F489L	probably benign	Het

Other mutations in Col6a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00573:Col6a4	APN	9	106022896	missense	probably benign	0.00
IGL00691:Col6a4	APN	9	106057407	missense	probably damaging	1.00
IGL01508:Col6a4	APN	9	106013605	missense	possibly damaging	0.95
IGL01580:Col6a4	APN	9	106068198	missense	probably damaging	1.00
IGL01610:Col6a4	APN	9	106047707	splice site	probably benign
IGL01813:Col6a4	APN	9	106077253	missense	probably damaging	1.00
IGL01933:Col6a4	APN	9	106060114	missense	probably benign	0.04
IGL01973:Col6a4	APN	9	106062894	missense	probably damaging	1.00
IGL02053:Col6a4	APN	9	106063095	missense	possibly damaging	0.92
IGL02063:Col6a4	APN	9	106057418	missense	probably benign	0.01
IGL02065:Col6a4	APN	9	106077103	missense	probably damaging	0.99
IGL02106:Col6a4	APN	9	106063105	missense	possibly damaging	0.95
IGL02220:Col6a4	APN	9	106062942	missense	possibly damaging	0.91
IGL02228:Col6a4	APN	9	106068078	missense	probably benign
IGL02234:Col6a4	APN	9	106013432	missense	possibly damaging	0.92
IGL02294:Col6a4	APN	9	106066732	missense	probably benign	0.04
IGL02314:Col6a4	APN	9	105997156	missense	probably damaging	0.99
IGL03065:Col6a4	APN	9	106041164	splice site	probably benign
IGL03086:Col6a4	APN	9	106082862	splice site	probably benign
IGL03185:Col6a4	APN	9	106019454	missense	probably damaging	0.97
R0092:Col6a4	UTSW	9	106013314	missense	probably benign	0.04
R0095:Col6a4	UTSW	9	106075356	missense	probably benign	0.03
R0230:Col6a4	UTSW	9	106072366	missense	probably benign	0.11
R0359:Col6a4	UTSW	9	105997146	missense	probably benign
R0415:Col6a4	UTSW	9	106075080	missense	probably damaging	0.99
R0433:Col6a4	UTSW	9	106067994	missense	probably damaging	0.99
R0450:Col6a4	UTSW	9	106080547	missense	probably damaging	1.00
R0469:Col6a4	UTSW	9	106080547	missense	probably damaging	1.00
R0490:Col6a4	UTSW	9	106013770	missense	probably damaging	0.99
R0621:Col6a4	UTSW	9	106066791	missense	probably damaging	0.97
R0667:Col6a4	UTSW	9	106029959	splice site	probably benign
R0681:Col6a4	UTSW	9	106067144	nonsense	probably null
R0690:Col6a4	UTSW	9	106028187	splice site	probably benign
R0714:Col6a4	UTSW	9	106017903	unclassified	probably benign
R0788:Col6a4	UTSW	9	106071998	missense	probably benign	0.15
R1036:Col6a4	UTSW	9	106068198	missense	probably damaging	1.00
R1296:Col6a4	UTSW	9	106062853	missense	possibly damaging	0.47
R1386:Col6a4	UTSW	9	106062945	missense	probably benign	0.15
R1484:Col6a4	UTSW	9	106013302	critical splice donor site	probably null
R1528:Col6a4	UTSW	9	106075220	missense	probably damaging	0.99
R1555:Col6a4	UTSW	9	106000886	missense	possibly damaging	0.93
R1622:Col6a4	UTSW	9	105997135	missense	probably benign	0.01
R1653:Col6a4	UTSW	9	106072409	missense	probably damaging	0.99
R1720:Col6a4	UTSW	9	106026472	missense	probably damaging	1.00
R1768:Col6a4	UTSW	9	106080100	missense	probably benign
R1941:Col6a4	UTSW	9	106075010	missense	probably benign	0.00
R2092:Col6a4	UTSW	9	106060331	missense	probably damaging	1.00
R2134:Col6a4	UTSW	9	106066661	missense	probably benign	0.09
R2149:Col6a4	UTSW	9	106076929	missense	probably benign	0.00
R2174:Col6a4	UTSW	9	106060132	missense	probably damaging	0.98
R2204:Col6a4	UTSW	9	106060132	missense	probably damaging	0.98
R2248:Col6a4	UTSW	9	106079959	missense	probably benign	0.15
R2568:Col6a4	UTSW	9	106063076	missense	possibly damaging	0.90
R3750:Col6a4	UTSW	9	106020665	critical splice acceptor site	probably null
R3751:Col6a4	UTSW	9	106072114	missense	probably damaging	0.98
R3776:Col6a4	UTSW	9	106051701	nonsense	probably null
R3872:Col6a4	UTSW	9	106013659	missense	possibly damaging	0.95
R4043:Col6a4	UTSW	9	106072411	nonsense	probably null
R4056:Col6a4	UTSW	9	106026466	missense	probably damaging	0.98
R4212:Col6a4	UTSW	9	106075370	missense	probably benign	0.28
R4417:Col6a4	UTSW	9	106072016	missense	probably damaging	0.99
R4683:Col6a4	UTSW	9	106080130	missense	probably benign	0.00
R4719:Col6a4	UTSW	9	106068252	missense	probably damaging	0.99
R4791:Col6a4	UTSW	9	106080202	missense	possibly damaging	0.68
R4833:Col6a4	UTSW	9	106071979	missense	probably benign	0.00
R4886:Col6a4	UTSW	9	106060072	missense	probably benign	0.00
R4998:Col6a4	UTSW	9	105990778	utr 3 prime	probably benign
R5091:Col6a4	UTSW	9	106075063	missense	probably damaging	1.00
R5113:Col6a4	UTSW	9	106066960	missense	possibly damaging	0.89
R5129:Col6a4	UTSW	9	106013377	missense	probably damaging	0.98
R5231:Col6a4	UTSW	9	106025531	missense	probably damaging	0.96
R5297:Col6a4	UTSW	9	106074867	missense	probably benign	0.02
R5352:Col6a4	UTSW	9	106061544	missense	probably damaging	1.00
R5438:Col6a4	UTSW	9	106013696	missense	possibly damaging	0.95
R5518:Col6a4	UTSW	9	106072188	missense	possibly damaging	0.68
R5657:Col6a4	UTSW	9	106072198	missense	probably damaging	0.99
R5660:Col6a4	UTSW	9	105996116	missense	probably benign	0.01
R5662:Col6a4	UTSW	9	106068001	missense	probably damaging	0.99
R5777:Col6a4	UTSW	9	106013696	missense	possibly damaging	0.95
R5800:Col6a4	UTSW	9	106080275	missense	probably damaging	0.99
R5929:Col6a4	UTSW	9	106063044	missense	probably benign	0.15
R5999:Col6a4	UTSW	9	106067921	missense	probably benign	0.11
R6243:Col6a4	UTSW	9	106013390	missense	possibly damaging	0.95
R6285:Col6a4	UTSW	9	106074986	missense	probably damaging	0.96
R6288:Col6a4	UTSW	9	106068263	missense	probably damaging	0.99
R6361:Col6a4	UTSW	9	106066703	missense	probably benign	0.28
R6485:Col6a4	UTSW	9	106076870	critical splice donor site	probably null
R6490:Col6a4	UTSW	9	106074992	nonsense	probably null
R6537:Col6a4	UTSW	9	106067954	missense	possibly damaging	0.87
R6598:Col6a4	UTSW	9	106000412	missense	probably damaging	0.99
R6643:Col6a4	UTSW	9	106000631	missense	probably damaging	0.96
R6905:Col6a4	UTSW	9	106060318	splice site	probably null
R7015:Col6a4	UTSW	9	106033755	critical splice donor site	probably null
R7027:Col6a4	UTSW	9	106067014	missense	probably damaging	1.00
R7088:Col6a4	UTSW	9	106000686	missense	possibly damaging	0.56
R7200:Col6a4	UTSW	9	106072249	missense	possibly damaging	0.68
R7238:Col6a4	UTSW	9	106000320	missense	probably damaging	0.99
R7273:Col6a4	UTSW	9	106000457	missense	possibly damaging	0.92
R7335:Col6a4	UTSW	9	106076892	missense	possibly damaging	0.90
R7418:Col6a4	UTSW	9	106022915	missense	probably damaging	1.00
R7421:Col6a4	UTSW	9	106020795	missense	probably damaging	0.99
R7530:Col6a4	UTSW	9	106068390	missense	probably damaging	0.99
R7600:Col6a4	UTSW	9	106066999	missense	possibly damaging	0.86
R7701:Col6a4	UTSW	9	106082888	missense	probably benign	0.17
R7830:Col6a4	UTSW	9	106075390	missense	probably damaging	0.99
R7881:Col6a4	UTSW	9	106080298	missense	probably benign	0.14
R8157:Col6a4	UTSW	9	106067898	missense	possibly damaging	0.92
R8292:Col6a4	UTSW	9	106076877	missense	probably benign	0.01
R8309:Col6a4	UTSW	9	106075215	missense	probably benign	0.08
R8336:Col6a4	UTSW	9	106075329	missense	possibly damaging	0.65
R8359:Col6a4	UTSW	9	106068384	missense	probably benign	0.00
R8530:Col6a4	UTSW	9	106080505	missense	probably benign	0.31
R8556:Col6a4	UTSW	9	106067053	missense	probably damaging	0.96
R8832:Col6a4	UTSW	9	106072154	missense	probably benign
R9001:Col6a4	UTSW	9	106067171	missense	probably benign	0.26
R9009:Col6a4	UTSW	9	106077205	missense	probably benign	0.38
R9069:Col6a4	UTSW	9	106074939	missense	possibly damaging	0.85
R9155:Col6a4	UTSW	9	106075010	missense	probably benign
R9175:Col6a4	UTSW	9	106080361	missense	probably benign
R9176:Col6a4	UTSW	9	106061556	missense	probably damaging	1.00
R9295:Col6a4	UTSW	9	106080535	missense	probably damaging	1.00
R9298:Col6a4	UTSW	9	106068335	missense	probably damaging	0.96
R9389:Col6a4	UTSW	9	106000784	missense	probably damaging	1.00
R9424:Col6a4	UTSW	9	106068072	missense	probably benign	0.30
R9576:Col6a4	UTSW	9	106068072	missense	probably benign	0.30
RF022:Col6a4	UTSW	9	106077008	missense	probably damaging	0.99
X0025:Col6a4	UTSW	9	106000455	missense	probably damaging	0.99
Z1176:Col6a4	UTSW	9	106000797	missense	probably benign
Z1176:Col6a4	UTSW	9	106000870	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACATCTCAGGGCAGAGCTTC -3'
(R):5'- TCCCTGGATATGTATCAAAGCGC -3'

Sequencing Primer
(F):5'- ATCTCAGGGCAGAGCTTCTTTTTAAG -3'
(R):5'- GGATATGTATCAAAGCGCTGCCC -3'

Posted On

2018-11-28