Incidental Mutation 'R2187:Epha7'
ID237860
Institutional Source Beutler Lab
Gene Symbol Epha7
Ensembl Gene ENSMUSG00000028289
Gene NameEph receptor A7
SynonymsEhk3, Hek11, Cek11, MDK1, Ebk, Mdk1
MMRRC Submission 040189-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.656) question?
Stock #R2187 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location28813131-28967499 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28942648 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 566 (T566S)
Ref Sequence ENSEMBL: ENSMUSP00000103829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029964] [ENSMUST00000080934] [ENSMUST00000108191] [ENSMUST00000108194]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029964
AA Change: T566S

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029964
Gene: ENSMUSG00000028289
AA Change: T566S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EPH_lbd 32 205 3.24e-126 SMART
FN3 332 422 2.39e-8 SMART
FN3 443 524 3.12e-12 SMART
Pfam:EphA2_TM 557 630 4.4e-25 PFAM
TyrKc 633 890 8.84e-139 SMART
SAM 920 987 1.26e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000080934
AA Change: T566S

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000079735
Gene: ENSMUSG00000028289
AA Change: T566S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EPH_lbd 32 205 3.24e-126 SMART
FN3 332 422 2.39e-8 SMART
FN3 443 524 3.12e-12 SMART
transmembrane domain 556 578 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108191
AA Change: T566S

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103826
Gene: ENSMUSG00000028289
AA Change: T566S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EPH_lbd 32 205 3.24e-126 SMART
FN3 332 422 2.39e-8 SMART
FN3 443 524 3.12e-12 SMART
Pfam:EphA2_TM 556 626 2.9e-23 PFAM
TyrKc 629 886 8.84e-139 SMART
SAM 916 983 1.26e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108194
AA Change: T566S

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103829
Gene: ENSMUSG00000028289
AA Change: T566S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EPH_lbd 32 205 3.24e-126 SMART
FN3 332 422 2.39e-8 SMART
FN3 443 524 3.12e-12 SMART
transmembrane domain 556 578 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129912
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Increased expression of this gene is associated with multiple forms of carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Some homozygous mutants display anencephaly. Mutants also exhibit increased proliferation of neural progenitor cells in the lateral ventricle wall of the adult brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A G 3: 92,868,615 S254P probably damaging Het
Abcg1 T A 17: 31,105,517 S245R probably damaging Het
AI597479 T A 1: 43,100,823 W70R probably damaging Het
Ankrd55 A G 13: 112,383,505 S575G probably benign Het
Bfsp2 T A 9: 103,426,777 K343* probably null Het
Cant1 A T 11: 118,408,841 Y227* probably null Het
Cd2bp2 T C 7: 127,194,791 N109D probably benign Het
Chmp6 A G 11: 119,916,736 E135G possibly damaging Het
Dsp T G 13: 38,176,407 S329R probably damaging Het
Epha5 A T 5: 84,086,364 F767L probably damaging Het
Erap1 A T 13: 74,662,405 I288F probably damaging Het
Erich6 A G 3: 58,629,845 probably null Het
Fbxo10 A G 4: 45,058,531 V402A probably benign Het
Fndc1 T A 17: 7,741,772 I1604F probably damaging Het
Foxd4 T G 19: 24,899,855 Q327P probably damaging Het
Fxn T A 19: 24,280,489 N26I probably benign Het
Hsf5 G T 11: 87,638,184 G582C possibly damaging Het
Itga8 A G 2: 12,194,420 V522A possibly damaging Het
Lyst C T 13: 13,709,341 T2938I possibly damaging Het
Mib2 T C 4: 155,654,933 E863G possibly damaging Het
Mrgpra9 A G 7: 47,235,049 F290S probably damaging Het
Mst1 T C 9: 108,084,340 Y599H possibly damaging Het
Mylk4 T C 13: 32,722,013 I165V probably damaging Het
Nipsnap2 T C 5: 129,746,473 probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Nup93 T A 8: 94,300,850 S295R probably damaging Het
Nutm2 A T 13: 50,467,417 Q6L probably benign Het
Olfr11 A T 13: 21,639,385 I46N probably damaging Het
Olfr1445 T A 19: 12,884,255 C125S probably damaging Het
Olfr820 A G 10: 130,017,688 E109G probably damaging Het
Olfr988 T G 2: 85,353,915 S4R probably benign Het
Pip5k1a A T 3: 95,071,918 L189Q probably damaging Het
Plekha4 C T 7: 45,549,274 R574C probably damaging Het
Ppp2cb A G 8: 33,610,677 E42G possibly damaging Het
Prkd3 T A 17: 78,975,554 Q244L probably benign Het
Ptpn14 C T 1: 189,863,228 R1023* probably null Het
Ptpra A G 2: 130,504,299 T127A probably benign Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Rasgrf1 T C 9: 89,994,835 I751T possibly damaging Het
Rbm27 A G 18: 42,325,957 K697R probably damaging Het
Rhoa C T 9: 108,335,153 T127M probably benign Het
Rnpepl1 A G 1: 92,916,895 S370G probably null Het
Sdk1 C T 5: 142,114,574 T1453I probably damaging Het
Sel1l2 A G 2: 140,230,873 L614S probably damaging Het
Slc6a20b T A 9: 123,598,588 I419F probably damaging Het
Slc8a1 C T 17: 81,648,553 S352N possibly damaging Het
Spta1 A G 1: 174,192,966 D547G probably damaging Het
Tc2n G A 12: 101,706,544 T46I probably damaging Het
Terb1 T A 8: 104,472,884 Y476F probably benign Het
Trim12a T A 7: 104,304,192 E237D probably damaging Het
Usp47 T C 7: 112,067,191 L309P probably damaging Het
Other mutations in Epha7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Epha7 APN 4 28961285 intron probably benign
IGL00849:Epha7 APN 4 28870662 missense possibly damaging 0.63
IGL00898:Epha7 APN 4 28938693 missense probably damaging 1.00
IGL02036:Epha7 APN 4 28950509 missense probably damaging 1.00
IGL02227:Epha7 APN 4 28821587 missense possibly damaging 0.85
IGL02237:Epha7 APN 4 28949325 splice site probably null
IGL02376:Epha7 APN 4 28951287 missense probably damaging 1.00
IGL02424:Epha7 APN 4 28948790 intron probably benign
IGL02519:Epha7 APN 4 28821494 missense possibly damaging 0.91
IGL02522:Epha7 APN 4 28821494 missense possibly damaging 0.91
IGL02524:Epha7 APN 4 28821494 missense possibly damaging 0.91
IGL02602:Epha7 APN 4 28871877 missense possibly damaging 0.88
PIT4514001:Epha7 UTSW 4 28961355 nonsense probably null
R0001:Epha7 UTSW 4 28961279 intron probably benign
R0011:Epha7 UTSW 4 28962564 missense probably benign 0.03
R0011:Epha7 UTSW 4 28962564 missense probably benign 0.03
R0310:Epha7 UTSW 4 28961301 missense probably benign 0.33
R0373:Epha7 UTSW 4 28935700 splice site probably null
R0496:Epha7 UTSW 4 28821292 missense probably damaging 1.00
R0554:Epha7 UTSW 4 28951401 missense probably damaging 1.00
R0632:Epha7 UTSW 4 28821104 missense probably damaging 1.00
R1677:Epha7 UTSW 4 28947571 nonsense probably null
R1883:Epha7 UTSW 4 28950362 missense possibly damaging 0.58
R1919:Epha7 UTSW 4 28963969 missense possibly damaging 0.48
R1952:Epha7 UTSW 4 28950474 missense probably damaging 0.97
R1999:Epha7 UTSW 4 28938686 nonsense probably null
R2308:Epha7 UTSW 4 28821503 missense possibly damaging 0.91
R2417:Epha7 UTSW 4 28947579 missense probably damaging 1.00
R3911:Epha7 UTSW 4 28938680 missense probably benign 0.01
R4350:Epha7 UTSW 4 28950393 missense probably damaging 0.98
R4688:Epha7 UTSW 4 28821367 missense probably damaging 1.00
R4702:Epha7 UTSW 4 28961425 missense probably damaging 1.00
R4957:Epha7 UTSW 4 28871892 missense probably damaging 0.99
R5364:Epha7 UTSW 4 28950557 missense probably damaging 1.00
R5661:Epha7 UTSW 4 28946217 splice site probably null
R5820:Epha7 UTSW 4 28949365 missense probably damaging 1.00
R6038:Epha7 UTSW 4 28821521 missense probably damaging 1.00
R6038:Epha7 UTSW 4 28821521 missense probably damaging 1.00
R6592:Epha7 UTSW 4 28813482 critical splice donor site probably null
R6783:Epha7 UTSW 4 28950528 missense possibly damaging 0.94
R6991:Epha7 UTSW 4 28821489 missense probably damaging 1.00
R7152:Epha7 UTSW 4 28935826 missense possibly damaging 0.94
R7232:Epha7 UTSW 4 28951279 missense probably damaging 1.00
R7261:Epha7 UTSW 4 28813418 missense probably benign 0.04
R7365:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7367:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7368:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7413:Epha7 UTSW 4 28871838 missense probably benign 0.00
R7603:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7604:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7605:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7607:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7608:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7609:Epha7 UTSW 4 28871937 missense probably benign 0.07
R7610:Epha7 UTSW 4 28871937 missense probably benign 0.07
R8073:Epha7 UTSW 4 28821022 missense probably damaging 1.00
R8263:Epha7 UTSW 4 28821149 missense probably damaging 1.00
R8334:Epha7 UTSW 4 28938777 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TCTTGCACTTCCTTAAAATTCACAAA -3'
(R):5'- TTGATTTGGGGAAAATAAAAGCAATG -3'

Sequencing Primer
(F):5'- TCCTCCTAGCCGTGAGT -3'
(R):5'- TTGGGGAAAATAAAAGCAATGAACTG -3'
Posted On2014-10-02