Incidental Mutation 'R2273:Setx'
Institutional Source Beutler Lab
Gene Symbol Setx
Ensembl Gene ENSMUSG00000043535
Gene Namesenataxin
SynonymsA930037J23Rik, Als4
MMRRC Submission 040273-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2273 (G1)
Quality Score217
Status Not validated
Chromosomal Location29124181-29182471 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GTGGCT to GT at 29154061 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061578]
Predicted Effect probably null
Transcript: ENSMUST00000061578
SMART Domains Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535

low complexity region 864 876 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
low complexity region 1058 1079 N/A INTRINSIC
low complexity region 1575 1594 N/A INTRINSIC
Pfam:AAA_11 1909 2194 1.9e-68 PFAM
Pfam:AAA_19 1924 2015 2.9e-11 PFAM
Pfam:AAA_12 2201 2402 1.1e-54 PFAM
low complexity region 2499 2516 N/A INTRINSIC
low complexity region 2576 2587 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135992
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Ank3 T A 10: 69,950,942 probably null Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atp11b A G 3: 35,828,613 I606V probably benign Het
Atp6v1h T A 1: 5,117,476 D222E probably damaging Het
Bco1 G A 8: 117,108,783 probably null Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Calhm3 T A 19: 47,157,547 Q73L probably damaging Het
Cdc42bpb C T 12: 111,302,167 E1200K probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Cfh C T 1: 140,102,825 V824M probably damaging Het
Ciapin1 A T 8: 94,831,787 V99E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cpxm2 TGCAGCAGCAGCAGCAGCAG TGCAGCAGCAGCAGCAG 7: 132,059,852 probably benign Het
Crim1 T C 17: 78,355,179 probably null Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Fat3 T C 9: 15,915,262 T4465A probably benign Het
Fdxacb1 A G 9: 50,772,021 E428G probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hivep2 T C 10: 14,132,443 M1595T probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Ift88 A G 14: 57,488,936 K684E possibly damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnc1 A G 7: 46,427,802 N343D probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Lrig1 A T 6: 94,608,143 D840E probably damaging Het
Lrrc7 A G 3: 158,187,059 S318P probably damaging Het
Map1b A C 13: 99,432,084 D1376E unknown Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mier2 T C 10: 79,544,534 I321V probably damaging Het
Mrc1 G A 2: 14,325,372 R1264Q probably damaging Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Olfr314 T C 11: 58,786,666 V144A probably benign Het
Olfr781 T C 10: 129,333,457 I192T probably benign Het
Olfr998 G T 2: 85,590,588 G16V probably damaging Het
Pcdhb4 C T 18: 37,308,926 L430F probably damaging Het
Ptpn2 T G 18: 67,677,802 M256L probably damaging Het
Rph3a C T 5: 120,973,304 R71H probably damaging Het
Rrm2b T A 15: 37,945,051 D148V possibly damaging Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Sned1 T A 1: 93,281,642 probably null Het
Sult1d1 T G 5: 87,556,028 N266T probably damaging Het
Tjp2 G T 19: 24,112,807 H624N probably benign Het
Tmcc3 G A 10: 94,578,915 V160I probably damaging Het
Tsr1 A T 11: 74,904,827 probably null Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vldlr A T 19: 27,248,015 T859S probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r94 T A 17: 18,257,331 M273L probably benign Het
Zc3h6 T C 2: 129,014,709 Y570H probably benign Het
Zhx2 A G 15: 57,823,169 S645G probably benign Het
Other mutations in Setx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Setx APN 2 29148445 missense possibly damaging 0.50
IGL00806:Setx APN 2 29127026 missense probably damaging 1.00
IGL01346:Setx APN 2 29144809 missense probably damaging 1.00
IGL01623:Setx APN 2 29163009 missense possibly damaging 0.70
IGL02351:Setx APN 2 29146964 missense probably benign 0.45
IGL02358:Setx APN 2 29146964 missense probably benign 0.45
IGL02378:Setx APN 2 29173726 splice site probably benign
IGL02388:Setx APN 2 29173653 missense probably damaging 1.00
IGL02408:Setx APN 2 29133930 missense probably damaging 1.00
IGL02425:Setx APN 2 29148408 missense probably benign 0.00
IGL03023:Setx APN 2 29145902 missense probably benign 0.02
IGL03351:Setx APN 2 29161799 missense probably benign 0.25
Addison UTSW 2 29158905 missense probably damaging 1.00
dallas UTSW 2 29154061 frame shift probably null
Denton UTSW 2 29145060 missense possibly damaging 0.81
doggie UTSW 2 29164550 missense probably damaging 1.00
Irving UTSW 2 29139221 missense probably damaging 0.99
IGL03014:Setx UTSW 2 29139411 missense probably damaging 1.00
PIT4403001:Setx UTSW 2 29133955 missense probably damaging 1.00
R0027:Setx UTSW 2 29139221 missense probably damaging 0.99
R0031:Setx UTSW 2 29176929 missense probably benign 0.02
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0092:Setx UTSW 2 29146293 missense probably benign 0.00
R0193:Setx UTSW 2 29179673 missense probably benign 0.21
R0281:Setx UTSW 2 29179643 missense probably benign 0.00
R0401:Setx UTSW 2 29166289 nonsense probably null
R0413:Setx UTSW 2 29139278 missense probably damaging 1.00
R0517:Setx UTSW 2 29157133 missense probably benign 0.00
R0536:Setx UTSW 2 29158248 missense possibly damaging 0.46
R0617:Setx UTSW 2 29146807 missense possibly damaging 0.86
R1183:Setx UTSW 2 29180092 missense probably benign
R1331:Setx UTSW 2 29179686 missense probably benign
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1482:Setx UTSW 2 29162992 missense probably damaging 0.99
R1599:Setx UTSW 2 29140373 missense probably benign 0.04
R1663:Setx UTSW 2 29126905 missense probably damaging 1.00
R1909:Setx UTSW 2 29163009 missense possibly damaging 0.70
R2117:Setx UTSW 2 29130301 missense probably benign 0.01
R2207:Setx UTSW 2 29154061 frame shift probably null
R2221:Setx UTSW 2 29154061 frame shift probably null
R2223:Setx UTSW 2 29148537 missense possibly damaging 0.89
R2223:Setx UTSW 2 29154061 frame shift probably null
R2274:Setx UTSW 2 29154061 frame shift probably null
R2275:Setx UTSW 2 29154061 frame shift probably null
R2309:Setx UTSW 2 29158904 missense probably damaging 1.00
R2328:Setx UTSW 2 29154060 frame shift probably null
R2328:Setx UTSW 2 29154061 frame shift probably null
R2329:Setx UTSW 2 29154061 frame shift probably null
R2331:Setx UTSW 2 29154061 frame shift probably null
R2332:Setx UTSW 2 29154061 frame shift probably null
R2429:Setx UTSW 2 29179898 missense probably benign 0.00
R2438:Setx UTSW 2 29154061 frame shift probably null
R2439:Setx UTSW 2 29154061 frame shift probably null
R2496:Setx UTSW 2 29144801 missense probably benign 0.11
R2858:Setx UTSW 2 29154061 frame shift probably null
R2859:Setx UTSW 2 29154061 frame shift probably null
R2884:Setx UTSW 2 29148625 missense probably damaging 0.98
R2885:Setx UTSW 2 29148625 missense probably damaging 0.98
R2886:Setx UTSW 2 29148625 missense probably damaging 0.98
R2915:Setx UTSW 2 29172324 missense probably damaging 0.99
R2921:Setx UTSW 2 29154060 small deletion probably benign
R2921:Setx UTSW 2 29154061 frame shift probably null
R2923:Setx UTSW 2 29154061 frame shift probably null
R3426:Setx UTSW 2 29154061 frame shift probably null
R3609:Setx UTSW 2 29154061 frame shift probably null
R3610:Setx UTSW 2 29154061 frame shift probably null
R3731:Setx UTSW 2 29154061 frame shift probably null
R3813:Setx UTSW 2 29154061 frame shift probably null
R3835:Setx UTSW 2 29145060 missense possibly damaging 0.81
R3871:Setx UTSW 2 29145741 missense probably damaging 0.98
R4013:Setx UTSW 2 29154061 frame shift probably null
R4014:Setx UTSW 2 29154061 frame shift probably null
R4015:Setx UTSW 2 29154061 frame shift probably null
R4017:Setx UTSW 2 29154061 frame shift probably null
R4246:Setx UTSW 2 29154061 frame shift probably null
R4248:Setx UTSW 2 29154061 frame shift probably null
R4297:Setx UTSW 2 29154061 frame shift probably null
R4298:Setx UTSW 2 29154061 frame shift probably null
R4539:Setx UTSW 2 29179748 missense probably benign 0.14
R4590:Setx UTSW 2 29144809 missense probably damaging 1.00
R4632:Setx UTSW 2 29148615 missense probably benign 0.23
R4782:Setx UTSW 2 29144046 missense probably damaging 0.99
R4801:Setx UTSW 2 29146373 missense probably benign 0.14
R4802:Setx UTSW 2 29146373 missense probably benign 0.14
R4975:Setx UTSW 2 29164550 missense probably damaging 1.00
R5040:Setx UTSW 2 29139338 missense probably damaging 1.00
R5133:Setx UTSW 2 29180081 missense probably benign 0.02
R5208:Setx UTSW 2 29166367 missense possibly damaging 0.63
R5237:Setx UTSW 2 29146983 missense probably benign 0.00
R5248:Setx UTSW 2 29148418 missense probably benign 0.26
R5288:Setx UTSW 2 29134033 critical splice donor site probably null
R5385:Setx UTSW 2 29134033 critical splice donor site probably null
R5387:Setx UTSW 2 29147594 missense probably benign 0.00
R5407:Setx UTSW 2 29145474 missense probably benign 0.00
R5685:Setx UTSW 2 29171280 missense probably damaging 1.00
R6110:Setx UTSW 2 29140290 missense probably damaging 1.00
R6136:Setx UTSW 2 29148027 missense probably benign 0.01
R6310:Setx UTSW 2 29176935 missense possibly damaging 0.57
R6328:Setx UTSW 2 29174462 intron probably benign
R6358:Setx UTSW 2 29171348 missense possibly damaging 0.79
R6384:Setx UTSW 2 29173558 missense probably damaging 1.00
R6400:Setx UTSW 2 29130274 missense probably damaging 0.97
R6572:Setx UTSW 2 29173694 missense possibly damaging 0.63
R6662:Setx UTSW 2 29158114 missense probably damaging 0.97
R6898:Setx UTSW 2 29148108 missense probably benign 0.00
R7188:Setx UTSW 2 29148172 missense probably benign 0.02
R7332:Setx UTSW 2 29146626 missense probably benign 0.00
R7357:Setx UTSW 2 29130301 missense probably benign 0.01
R7556:Setx UTSW 2 29146493 missense possibly damaging 0.88
R7646:Setx UTSW 2 29177549 missense possibly damaging 0.94
R7802:Setx UTSW 2 29147021 missense probably benign 0.02
R7810:Setx UTSW 2 29148651 missense probably benign 0.43
R7831:Setx UTSW 2 29157108 missense probably damaging 1.00
R7831:Setx UTSW 2 29179854 missense possibly damaging 0.75
R7843:Setx UTSW 2 29173569 missense probably damaging 1.00
R7850:Setx UTSW 2 29147418 missense probably damaging 1.00
R7858:Setx UTSW 2 29161550 missense probably damaging 1.00
R8121:Setx UTSW 2 29145034 missense possibly damaging 0.93
R8284:Setx UTSW 2 29145336 missense possibly damaging 0.46
R8301:Setx UTSW 2 29145690 missense possibly damaging 0.69
R8752:Setx UTSW 2 29158980 missense probably damaging 0.97
X0066:Setx UTSW 2 29147879 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-16