Mutagenetix > Incidental Mutations

Incidental Mutation 'R7831:Setx'

605596

Institutional Source

Beutler Lab

Gene Symbol

Setx

Ensembl Gene

ENSMUSG00000043535

Gene Name

senataxin

Synonyms

A930037J23Rik, Als4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7831 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

29124181-29182471 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 29157108 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 1866 (L1866S)

Ref Sequence

ENSEMBL: ENSMUSP00000051492 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061578]

Predicted Effect

probably damaging
Transcript: ENSMUST00000061578
AA Change: L1866S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535
AA Change: L1866S

Domain	Start	End	E-Value	Type
low complexity region	864	876	N/A	INTRINSIC
low complexity region	1002	1020	N/A	INTRINSIC
low complexity region	1058	1079	N/A	INTRINSIC
low complexity region	1575	1594	N/A	INTRINSIC
Pfam:AAA_11	1909	2194	1.9e-68	PFAM
Pfam:AAA_19	1924	2015	2.9e-11	PFAM
Pfam:AAA_12	2201	2402	1.1e-54	PFAM
low complexity region	2499	2516	N/A	INTRINSIC
low complexity region	2576	2587	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (87/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	G	A	11: 9,297,404	V2384I	possibly damaging	Het
Acsl1	A	G	8: 46,519,006	D297G	probably benign	Het
Ap2a1	C	A	7: 44,901,012	R944L	probably damaging	Het
Apbb1ip	A	G	2: 22,866,921	Y398C	probably damaging	Het
Atp8a2	A	T	14: 59,773,753	V968D	probably damaging	Het
Becn1	T	C	11: 101,290,453	T341A	probably benign	Het
Card11	G	T	5: 140,873,412	S1126R	possibly damaging	Het
Ccdc51	T	C	9: 109,091,990	L315S	probably damaging	Het
Cdk12	T	C	11: 98,249,827	L1298P	unknown	Het
Cep170b	A	T	12: 112,744,800	D1538V	probably benign	Het
Cfap52	A	T	11: 67,935,956	F348I	possibly damaging	Het
Clip1	A	T	5: 123,613,279	M813K		Het
Col19a1	G	A	1: 24,526,482	T256I	unknown	Het
Col6a3	A	T	1: 90,796,546	C2027*	probably null	Het
Crisp4	A	T	1: 18,128,789	N140K	probably benign	Het
Crocc2	G	T	1: 93,215,473	A1266S	probably benign	Het
Cyfip2	G	A	11: 46,196,446	R1206C	probably damaging	Het
Cyp24a1	T	A	2: 170,485,940	M461L	probably damaging	Het
Cyp2a5	C	T	7: 26,835,515	T51I	possibly damaging	Het
Cyp2b19	C	T	7: 26,767,140	H398Y	possibly damaging	Het
Cyp4a29	G	A	4: 115,250,170	V234I	probably benign	Het
Dicer1	T	G	12: 104,708,800	K734N	probably damaging	Het
Dnaic1	T	C	4: 41,614,695		probably null	Het
Entpd3	G	A	9: 120,543,959	G14D	probably damaging	Het
Ermp1	T	C	19: 29,617,967	T634A	probably benign	Het
Evc	C	T	5: 37,319,083	G374D	probably damaging	Het
Fam189b	G	A	3: 89,184,213		probably null	Het
Fcgbp	C	A	7: 28,106,979	T2124K	probably damaging	Het
Fgf8	G	A	19: 45,742,437	P50S	probably benign	Het
Fmnl1	C	T	11: 103,198,173	R1074W	unknown	Het
Galnt18	C	T	7: 111,556,458	V223M	possibly damaging	Het
Galnt2	A	G	8: 124,332,078	N295S	probably benign	Het
Gm9573	T	A	17: 35,618,759	T1512S	unknown	Het
Grip1	T	G	10: 120,018,106	V600G	probably damaging	Het
Insm2	T	A	12: 55,600,538	C356S	probably damaging	Het
Itpr2	T	A	6: 146,291,584	I1672F	probably benign	Het
Kdm1b	T	G	13: 47,050,622	N76K	probably benign	Het
Khnyn	T	A	14: 55,887,846		probably null	Het
Kidins220	C	T	12: 25,061,231	A1167V	possibly damaging	Het
Krt40	T	C	11: 99,541,261	D208G	probably benign	Het
Lars	T	A	18: 42,217,562	D894V	probably benign	Het
Lmx1a	A	T	1: 167,840,952	N266I	probably benign	Het
Mrgprb5	T	A	7: 48,168,249	K246M	probably benign	Het
Mrpl2	G	A	17: 46,648,672	G176R	possibly damaging	Het
Nell1	T	A	7: 49,982,800	F60L	possibly damaging	Het
Nnt	G	A	13: 119,370,094	A453V	possibly damaging	Het
Olfr366	C	T	2: 37,219,711	T74I	probably damaging	Het
Olfr398	A	C	11: 73,984,431	M59R	probably damaging	Het
Olfr697	T	A	7: 106,741,413	I174F	probably damaging	Het
Opa1	A	G	16: 29,648,937	K940R	probably benign	Het
Opn5	A	C	17: 42,580,619	I309S	probably null	Het
P3h3	T	G	6: 124,855,155	E256A	possibly damaging	Het
Pald1	G	T	10: 61,355,814	T65K	probably damaging	Het
Pcnx3	T	C	19: 5,685,961	Y279C	probably damaging	Het
Pik3c2b	G	A	1: 133,071,242	S367N	possibly damaging	Het
Pik3cb	T	C	9: 99,088,613	T342A	probably benign	Het
Pkd1l3	A	T	8: 109,631,358	E837D	possibly damaging	Het
Ppp2r2b	T	A	18: 42,701,532	Y191F	probably benign	Het
Ppp4r4	G	A	12: 103,590,821	E439K	possibly damaging	Het
Pqlc3	T	A	12: 16,997,631		probably null	Het
Ptprk	A	G	10: 28,568,408	I946V	possibly damaging	Het
Ror1	A	G	4: 100,441,098	N556S	probably benign	Het
Ryr3	C	T	2: 112,926,838	A391T	possibly damaging	Het
Selp	G	A	1: 164,145,015		probably null	Het
Slit2	A	G	5: 48,244,683	T805A	probably benign	Het
Sorbs3	T	G	14: 70,203,032	N89T	possibly damaging	Het
Sorl1	C	A	9: 42,089,961	V248L	probably benign	Het
Srebf2	T	A	15: 82,182,087	V612E	probably damaging	Het
Sv2c	T	A	13: 95,976,692	Y583F	probably damaging	Het
Tada1	G	T	1: 166,389,873	R193I	probably damaging	Het
Tnrc6b	C	G	15: 80,880,379	A694G	possibly damaging	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Ttn	C	T	2: 76,881,081	G8372D	unknown	Het
Ube2g2	A	G	10: 77,634,742	T68A		Het
Ubl7	T	G	9: 57,914,635	V89G	possibly damaging	Het
Ush2a	T	A	1: 188,759,841	I3109N	probably damaging	Het
Utp20	T	A	10: 88,762,770	K115*	probably null	Het
Vmn2r26	T	A	6: 124,039,799	Y407*	probably null	Het
Yod1	G	T	1: 130,719,249	V288F	probably damaging	Het
Zbed5	A	C	5: 129,901,957	N249T	possibly damaging	Het
Zbtb5	T	C	4: 44,995,244	T47A	probably damaging	Het
Zcchc14	T	C	8: 121,605,245	T460A	not run	Het
Zfp712	A	C	13: 67,052,419		probably null	Het
Zfyve16	A	T	13: 92,522,328	H358Q	probably benign	Het

Other mutations in Setx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00688:Setx	APN	2	29148445	missense	possibly damaging	0.50
IGL00806:Setx	APN	2	29127026	missense	probably damaging	1.00
IGL01346:Setx	APN	2	29144809	missense	probably damaging	1.00
IGL01623:Setx	APN	2	29163009	missense	possibly damaging	0.70
IGL02351:Setx	APN	2	29146964	missense	probably benign	0.45
IGL02358:Setx	APN	2	29146964	missense	probably benign	0.45
IGL02378:Setx	APN	2	29173726	splice site	probably benign
IGL02388:Setx	APN	2	29173653	missense	probably damaging	1.00
IGL02408:Setx	APN	2	29133930	missense	probably damaging	1.00
IGL02425:Setx	APN	2	29148408	missense	probably benign	0.00
IGL03023:Setx	APN	2	29145902	missense	probably benign	0.02
IGL03351:Setx	APN	2	29161799	missense	probably benign	0.25
Addison	UTSW	2	29158905	missense	probably damaging	1.00
dallas	UTSW	2	29154061	frame shift	probably null
Denton	UTSW	2	29145060	missense	possibly damaging	0.81
doggie	UTSW	2	29164550	missense	probably damaging	1.00
Irving	UTSW	2	29139221	missense	probably damaging	0.99
IGL03014:Setx	UTSW	2	29139411	missense	probably damaging	1.00
PIT4403001:Setx	UTSW	2	29133955	missense	probably damaging	1.00
R0027:Setx	UTSW	2	29139221	missense	probably damaging	0.99
R0031:Setx	UTSW	2	29176929	missense	probably benign	0.02
R0070:Setx	UTSW	2	29161525	missense	probably benign	0.00
R0070:Setx	UTSW	2	29161525	missense	probably benign	0.00
R0092:Setx	UTSW	2	29146293	missense	probably benign	0.00
R0193:Setx	UTSW	2	29179673	missense	probably benign	0.21
R0281:Setx	UTSW	2	29179643	missense	probably benign	0.00
R0401:Setx	UTSW	2	29166289	nonsense	probably null
R0413:Setx	UTSW	2	29139278	missense	probably damaging	1.00
R0517:Setx	UTSW	2	29157133	missense	probably benign	0.00
R0536:Setx	UTSW	2	29158248	missense	possibly damaging	0.46
R0617:Setx	UTSW	2	29146807	missense	possibly damaging	0.86
R1183:Setx	UTSW	2	29180092	missense	probably benign
R1331:Setx	UTSW	2	29179686	missense	probably benign
R1465:Setx	UTSW	2	29140389	critical splice donor site	probably null
R1465:Setx	UTSW	2	29140389	critical splice donor site	probably null
R1467:Setx	UTSW	2	29158905	missense	probably damaging	1.00
R1467:Setx	UTSW	2	29158905	missense	probably damaging	1.00
R1482:Setx	UTSW	2	29162992	missense	probably damaging	0.99
R1599:Setx	UTSW	2	29140373	missense	probably benign	0.04
R1663:Setx	UTSW	2	29126905	missense	probably damaging	1.00
R1909:Setx	UTSW	2	29163009	missense	possibly damaging	0.70
R2117:Setx	UTSW	2	29130301	missense	probably benign	0.01
R2207:Setx	UTSW	2	29154061	frame shift	probably null
R2221:Setx	UTSW	2	29154061	frame shift	probably null
R2223:Setx	UTSW	2	29148537	missense	possibly damaging	0.89
R2223:Setx	UTSW	2	29154061	frame shift	probably null
R2273:Setx	UTSW	2	29154061	frame shift	probably null
R2274:Setx	UTSW	2	29154061	frame shift	probably null
R2275:Setx	UTSW	2	29154061	frame shift	probably null
R2309:Setx	UTSW	2	29158904	missense	probably damaging	1.00
R2328:Setx	UTSW	2	29154060	frame shift	probably null
R2328:Setx	UTSW	2	29154061	frame shift	probably null
R2329:Setx	UTSW	2	29154061	frame shift	probably null
R2331:Setx	UTSW	2	29154061	frame shift	probably null
R2332:Setx	UTSW	2	29154061	frame shift	probably null
R2429:Setx	UTSW	2	29179898	missense	probably benign	0.00
R2438:Setx	UTSW	2	29154061	frame shift	probably null
R2439:Setx	UTSW	2	29154061	frame shift	probably null
R2496:Setx	UTSW	2	29144801	missense	probably benign	0.11
R2858:Setx	UTSW	2	29154061	frame shift	probably null
R2859:Setx	UTSW	2	29154061	frame shift	probably null
R2884:Setx	UTSW	2	29148625	missense	probably damaging	0.98
R2885:Setx	UTSW	2	29148625	missense	probably damaging	0.98
R2886:Setx	UTSW	2	29148625	missense	probably damaging	0.98
R2915:Setx	UTSW	2	29172324	missense	probably damaging	0.99
R2921:Setx	UTSW	2	29154060	small deletion	probably benign
R2921:Setx	UTSW	2	29154061	frame shift	probably null
R2923:Setx	UTSW	2	29154061	frame shift	probably null
R3426:Setx	UTSW	2	29154061	frame shift	probably null
R3609:Setx	UTSW	2	29154061	frame shift	probably null
R3610:Setx	UTSW	2	29154061	frame shift	probably null
R3731:Setx	UTSW	2	29154061	frame shift	probably null
R3813:Setx	UTSW	2	29154061	frame shift	probably null
R3835:Setx	UTSW	2	29145060	missense	possibly damaging	0.81
R3871:Setx	UTSW	2	29145741	missense	probably damaging	0.98
R4013:Setx	UTSW	2	29154061	frame shift	probably null
R4014:Setx	UTSW	2	29154061	frame shift	probably null
R4015:Setx	UTSW	2	29154061	frame shift	probably null
R4017:Setx	UTSW	2	29154061	frame shift	probably null
R4246:Setx	UTSW	2	29154061	frame shift	probably null
R4248:Setx	UTSW	2	29154061	frame shift	probably null
R4297:Setx	UTSW	2	29154061	frame shift	probably null
R4298:Setx	UTSW	2	29154061	frame shift	probably null
R4539:Setx	UTSW	2	29179748	missense	probably benign	0.14
R4590:Setx	UTSW	2	29144809	missense	probably damaging	1.00
R4632:Setx	UTSW	2	29148615	missense	probably benign	0.23
R4782:Setx	UTSW	2	29144046	missense	probably damaging	0.99
R4801:Setx	UTSW	2	29146373	missense	probably benign	0.14
R4802:Setx	UTSW	2	29146373	missense	probably benign	0.14
R4975:Setx	UTSW	2	29164550	missense	probably damaging	1.00
R5040:Setx	UTSW	2	29139338	missense	probably damaging	1.00
R5133:Setx	UTSW	2	29180081	missense	probably benign	0.02
R5208:Setx	UTSW	2	29166367	missense	possibly damaging	0.63
R5237:Setx	UTSW	2	29146983	missense	probably benign	0.00
R5248:Setx	UTSW	2	29148418	missense	probably benign	0.26
R5288:Setx	UTSW	2	29134033	critical splice donor site	probably null
R5385:Setx	UTSW	2	29134033	critical splice donor site	probably null
R5387:Setx	UTSW	2	29147594	missense	probably benign	0.00
R5407:Setx	UTSW	2	29145474	missense	probably benign	0.00
R5685:Setx	UTSW	2	29171280	missense	probably damaging	1.00
R6110:Setx	UTSW	2	29140290	missense	probably damaging	1.00
R6136:Setx	UTSW	2	29148027	missense	probably benign	0.01
R6310:Setx	UTSW	2	29176935	missense	possibly damaging	0.57
R6328:Setx	UTSW	2	29174462	intron	probably benign
R6358:Setx	UTSW	2	29171348	missense	possibly damaging	0.79
R6384:Setx	UTSW	2	29173558	missense	probably damaging	1.00
R6400:Setx	UTSW	2	29130274	missense	probably damaging	0.97
R6572:Setx	UTSW	2	29173694	missense	possibly damaging	0.63
R6662:Setx	UTSW	2	29158114	missense	probably damaging	0.97
R6898:Setx	UTSW	2	29148108	missense	probably benign	0.00
R7188:Setx	UTSW	2	29148172	missense	probably benign	0.02
R7332:Setx	UTSW	2	29146626	missense	probably benign	0.00
R7357:Setx	UTSW	2	29130301	missense	probably benign	0.01
R7556:Setx	UTSW	2	29146493	missense	possibly damaging	0.88
R7646:Setx	UTSW	2	29177549	missense	possibly damaging	0.94
R7802:Setx	UTSW	2	29147021	missense	probably benign	0.02
R7810:Setx	UTSW	2	29148651	missense	probably benign	0.43
R7831:Setx	UTSW	2	29179854	missense	possibly damaging	0.75
R7843:Setx	UTSW	2	29173569	missense	probably damaging	1.00
R7850:Setx	UTSW	2	29147418	missense	probably damaging	1.00
R7858:Setx	UTSW	2	29161550	missense	probably damaging	1.00
R8121:Setx	UTSW	2	29145034	missense	possibly damaging	0.93
R8284:Setx	UTSW	2	29145336	missense	possibly damaging	0.46
R8301:Setx	UTSW	2	29145690	missense	possibly damaging	0.69
X0066:Setx	UTSW	2	29147879	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCATTTGCAACAGTTCCACGTAG -3'
(R):5'- AAACTCCGCTGTGCATAAGC -3'

Sequencing Primer
(F):5'- GCCAGTCAAGTGTAAAAATCACTC -3'
(R):5'- GCATAAGGACCAGCAGCAGC -3'

Posted On

2019-12-20