Mutagenetix > Incidental Mutation

Incidental Mutation 'R4298:Setx'

323407

Institutional Source

Beutler Lab

Gene Symbol

Setx

Ensembl Gene

ENSMUSG00000043535

Gene Name

senataxin

Synonyms

A930037J23Rik, Als4

MMRRC Submission

041086-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4298 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

29124181-29182471 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

GTGGCT to GT at 29154061 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

at position 1814 (1814)

Ref Sequence

ENSEMBL: ENSMUSP00000051492 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061578]

AlphaFold

A2AKX3

Predicted Effect

probably null
Transcript: ENSMUST00000061578
AA Change: 1814

SMART Domains

Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535
AA Change: 1814

Domain	Start	End	E-Value	Type
low complexity region	864	876	N/A	INTRINSIC
low complexity region	1002	1020	N/A	INTRINSIC
low complexity region	1058	1079	N/A	INTRINSIC
low complexity region	1575	1594	N/A	INTRINSIC
Pfam:AAA_11	1909	2194	1.9e-68	PFAM
Pfam:AAA_19	1924	2015	2.9e-11	PFAM
Pfam:AAA_12	2201	2402	1.1e-54	PFAM
low complexity region	2499	2516	N/A	INTRINSIC
low complexity region	2576	2587	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135992

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	T	C	8: 86,531,525		probably null	Het
Ccser2	T	A	14: 36,890,380	Q158L	possibly damaging	Het
Cct7	T	A	6: 85,468,173	C469S	probably damaging	Het
Chmp7	A	T	14: 69,719,201		probably null	Het
Clcn4	C	T	7: 7,296,738	D31N	possibly damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Ctdp1	A	T	18: 80,449,957	V441E	probably benign	Het
Cyp4a10	T	C	4: 115,532,692	L498P	probably damaging	Het
Dsc3	A	T	18: 19,980,754	N370K	possibly damaging	Het
Dusp12	G	A	1: 170,880,629	T173M	probably benign	Het
Ebf3	C	T	7: 137,225,229	R318Q	possibly damaging	Het
Epcam	T	C	17: 87,640,534		probably null	Het
Erich6	G	T	3: 58,624,291	A428D	probably benign	Het
Ext1	A	T	15: 53,345,125	I80N	probably benign	Het
Extl1	T	C	4: 134,357,658	E667G	probably damaging	Het
F2	T	G	2: 91,629,320		probably null	Het
Fbxw16	T	C	9: 109,446,557	I135V	probably benign	Het
Glipr1l1	A	T	10: 112,062,347	D119V	probably benign	Het
Gprc5b	G	A	7: 118,984,214	A144V	possibly damaging	Het
Lmbrd2	G	A	15: 9,165,795	R252H	possibly damaging	Het
Lyst	A	G	13: 13,634,887	T381A	probably damaging	Het
Mcpt4	A	T	14: 56,060,987	V97D	possibly damaging	Het
Nefh	A	G	11: 4,940,066	I851T	probably benign	Het
Nf1	A	T	11: 79,384,244	I44F	probably damaging	Het
Nyap2	A	T	1: 81,241,096	I278F	probably damaging	Het
Olfr1263	A	T	2: 90,015,649	T240S	probably benign	Het
Olfr268-ps1	G	T	2: 111,844,444		noncoding transcript	Het
Pdcd4	C	A	19: 53,919,661	P201Q	probably damaging	Het
Pramef25	A	T	4: 143,949,143	L371*	probably null	Het
Prdm11	T	C	2: 92,993,383	T179A	probably benign	Het
Qrfpr	T	A	3: 36,189,554	I133F	probably damaging	Het
Rack1	T	C	11: 48,801,626		probably benign	Het
Reln	A	C	5: 21,920,487	C2733G	probably damaging	Het
Rrs1	C	T	1: 9,546,223	R234C	possibly damaging	Het
Sag	G	C	1: 87,845,015	D402H	probably benign	Het
Sbk3	T	A	7: 4,969,980	T64S	probably benign	Het
Sh3gl1	C	T	17: 56,019,173	G111D	probably damaging	Het
Spata20	G	A	11: 94,483,088	R379W	probably damaging	Het
St3gal2	T	C	8: 110,962,359	M177T	probably benign	Het
Stk39	C	T	2: 68,390,940	G213D	probably damaging	Het
Szt2	A	G	4: 118,365,406		probably benign	Het
Taf1d	T	C	9: 15,308,643	S63P	probably damaging	Het
Tnfrsf13b	C	G	11: 61,140,817		probably null	Het
Ttn	G	T	2: 76,724,050	A30807D	probably damaging	Het
Unc119	A	G	11: 78,348,122	N158S	probably damaging	Het
Vmn2r116	T	A	17: 23,401,827	I845N	possibly damaging	Het
Vmn2r12	C	A	5: 109,091,964	M244I	probably benign	Het
Zdhhc4	A	G	5: 143,324,242	V87A	probably damaging	Het
Zwilch	A	G	9: 64,155,162		probably null	Het

Other mutations in Setx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00688:Setx	APN	2	29148445	missense	possibly damaging	0.50
IGL00806:Setx	APN	2	29127026	missense	probably damaging	1.00
IGL01346:Setx	APN	2	29144809	missense	probably damaging	1.00
IGL01623:Setx	APN	2	29163009	missense	possibly damaging	0.70
IGL02351:Setx	APN	2	29146964	missense	probably benign	0.45
IGL02358:Setx	APN	2	29146964	missense	probably benign	0.45
IGL02378:Setx	APN	2	29173726	splice site	probably benign
IGL02388:Setx	APN	2	29173653	missense	probably damaging	1.00
IGL02408:Setx	APN	2	29133930	missense	probably damaging	1.00
IGL02425:Setx	APN	2	29148408	missense	probably benign	0.00
IGL03023:Setx	APN	2	29145902	missense	probably benign	0.02
IGL03351:Setx	APN	2	29161799	missense	probably benign	0.25
Addison	UTSW	2	29158905	missense	probably damaging	1.00
dallas	UTSW	2	29154061	frame shift	probably null
Denton	UTSW	2	29145060	missense	possibly damaging	0.81
doggie	UTSW	2	29164550	missense	probably damaging	1.00
Irving	UTSW	2	29139221	missense	probably damaging	0.99
G1Funyon:Setx	UTSW	2	29145690	missense	possibly damaging	0.69
IGL03014:Setx	UTSW	2	29139411	missense	probably damaging	1.00
PIT4403001:Setx	UTSW	2	29133955	missense	probably damaging	1.00
R0027:Setx	UTSW	2	29139221	missense	probably damaging	0.99
R0031:Setx	UTSW	2	29176929	missense	probably benign	0.02
R0070:Setx	UTSW	2	29161525	missense	probably benign	0.00
R0070:Setx	UTSW	2	29161525	missense	probably benign	0.00
R0092:Setx	UTSW	2	29146293	missense	probably benign	0.00
R0193:Setx	UTSW	2	29179673	missense	probably benign	0.21
R0281:Setx	UTSW	2	29179643	missense	probably benign	0.00
R0401:Setx	UTSW	2	29166289	nonsense	probably null
R0413:Setx	UTSW	2	29139278	missense	probably damaging	1.00
R0517:Setx	UTSW	2	29157133	missense	probably benign	0.00
R0536:Setx	UTSW	2	29158248	missense	possibly damaging	0.46
R0617:Setx	UTSW	2	29146807	missense	possibly damaging	0.86
R1183:Setx	UTSW	2	29180092	missense	probably benign
R1331:Setx	UTSW	2	29179686	missense	probably benign
R1465:Setx	UTSW	2	29140389	critical splice donor site	probably null
R1465:Setx	UTSW	2	29140389	critical splice donor site	probably null
R1467:Setx	UTSW	2	29158905	missense	probably damaging	1.00
R1467:Setx	UTSW	2	29158905	missense	probably damaging	1.00
R1482:Setx	UTSW	2	29162992	missense	probably damaging	0.99
R1599:Setx	UTSW	2	29140373	missense	probably benign	0.04
R1663:Setx	UTSW	2	29126905	missense	probably damaging	1.00
R1909:Setx	UTSW	2	29163009	missense	possibly damaging	0.70
R2117:Setx	UTSW	2	29130301	missense	probably benign	0.01
R2207:Setx	UTSW	2	29154061	frame shift	probably null
R2221:Setx	UTSW	2	29154061	frame shift	probably null
R2223:Setx	UTSW	2	29148537	missense	possibly damaging	0.89
R2223:Setx	UTSW	2	29154061	frame shift	probably null
R2273:Setx	UTSW	2	29154061	frame shift	probably null
R2274:Setx	UTSW	2	29154061	frame shift	probably null
R2275:Setx	UTSW	2	29154061	frame shift	probably null
R2309:Setx	UTSW	2	29158904	missense	probably damaging	1.00
R2328:Setx	UTSW	2	29154060	frame shift	probably null
R2328:Setx	UTSW	2	29154061	frame shift	probably null
R2329:Setx	UTSW	2	29154061	frame shift	probably null
R2331:Setx	UTSW	2	29154061	frame shift	probably null
R2332:Setx	UTSW	2	29154061	frame shift	probably null
R2429:Setx	UTSW	2	29179898	missense	probably benign	0.00
R2438:Setx	UTSW	2	29154061	frame shift	probably null
R2439:Setx	UTSW	2	29154061	frame shift	probably null
R2496:Setx	UTSW	2	29144801	missense	probably benign	0.11
R2858:Setx	UTSW	2	29154061	frame shift	probably null
R2859:Setx	UTSW	2	29154061	frame shift	probably null
R2884:Setx	UTSW	2	29148625	missense	probably damaging	0.98
R2885:Setx	UTSW	2	29148625	missense	probably damaging	0.98
R2886:Setx	UTSW	2	29148625	missense	probably damaging	0.98
R2915:Setx	UTSW	2	29172324	missense	probably damaging	0.99
R2921:Setx	UTSW	2	29154060	small deletion	probably benign
R2921:Setx	UTSW	2	29154061	frame shift	probably null
R2923:Setx	UTSW	2	29154061	frame shift	probably null
R3426:Setx	UTSW	2	29154061	frame shift	probably null
R3609:Setx	UTSW	2	29154061	frame shift	probably null
R3610:Setx	UTSW	2	29154061	frame shift	probably null
R3731:Setx	UTSW	2	29154061	frame shift	probably null
R3813:Setx	UTSW	2	29154061	frame shift	probably null
R3835:Setx	UTSW	2	29145060	missense	possibly damaging	0.81
R3871:Setx	UTSW	2	29145741	missense	probably damaging	0.98
R4013:Setx	UTSW	2	29154061	frame shift	probably null
R4014:Setx	UTSW	2	29154061	frame shift	probably null
R4015:Setx	UTSW	2	29154061	frame shift	probably null
R4017:Setx	UTSW	2	29154061	frame shift	probably null
R4246:Setx	UTSW	2	29154061	frame shift	probably null
R4248:Setx	UTSW	2	29154061	frame shift	probably null
R4297:Setx	UTSW	2	29154061	frame shift	probably null
R4539:Setx	UTSW	2	29179748	missense	probably benign	0.14
R4590:Setx	UTSW	2	29144809	missense	probably damaging	1.00
R4632:Setx	UTSW	2	29148615	missense	probably benign	0.23
R4782:Setx	UTSW	2	29144046	missense	probably damaging	0.99
R4801:Setx	UTSW	2	29146373	missense	probably benign	0.14
R4802:Setx	UTSW	2	29146373	missense	probably benign	0.14
R4975:Setx	UTSW	2	29164550	missense	probably damaging	1.00
R5040:Setx	UTSW	2	29139338	missense	probably damaging	1.00
R5133:Setx	UTSW	2	29180081	missense	probably benign	0.02
R5208:Setx	UTSW	2	29166367	missense	possibly damaging	0.63
R5237:Setx	UTSW	2	29146983	missense	probably benign	0.00
R5248:Setx	UTSW	2	29148418	missense	probably benign	0.26
R5288:Setx	UTSW	2	29134033	critical splice donor site	probably null
R5385:Setx	UTSW	2	29134033	critical splice donor site	probably null
R5387:Setx	UTSW	2	29147594	missense	probably benign	0.00
R5407:Setx	UTSW	2	29145474	missense	probably benign	0.00
R5685:Setx	UTSW	2	29171280	missense	probably damaging	1.00
R6110:Setx	UTSW	2	29140290	missense	probably damaging	1.00
R6136:Setx	UTSW	2	29148027	missense	probably benign	0.01
R6310:Setx	UTSW	2	29176935	missense	possibly damaging	0.57
R6328:Setx	UTSW	2	29174462	intron	probably benign
R6358:Setx	UTSW	2	29171348	missense	possibly damaging	0.79
R6384:Setx	UTSW	2	29173558	missense	probably damaging	1.00
R6400:Setx	UTSW	2	29130274	missense	probably damaging	0.97
R6572:Setx	UTSW	2	29173694	missense	possibly damaging	0.63
R6662:Setx	UTSW	2	29158114	missense	probably damaging	0.97
R6898:Setx	UTSW	2	29148108	missense	probably benign	0.00
R7188:Setx	UTSW	2	29148172	missense	probably benign	0.02
R7332:Setx	UTSW	2	29146626	missense	probably benign	0.00
R7357:Setx	UTSW	2	29130301	missense	probably benign	0.01
R7556:Setx	UTSW	2	29146493	missense	possibly damaging	0.88
R7646:Setx	UTSW	2	29177549	missense	possibly damaging	0.94
R7802:Setx	UTSW	2	29147021	missense	probably benign	0.02
R7810:Setx	UTSW	2	29148651	missense	probably benign	0.43
R7831:Setx	UTSW	2	29157108	missense	probably damaging	1.00
R7831:Setx	UTSW	2	29179854	missense	possibly damaging	0.75
R7843:Setx	UTSW	2	29173569	missense	probably damaging	1.00
R7850:Setx	UTSW	2	29147418	missense	probably damaging	1.00
R7858:Setx	UTSW	2	29161550	missense	probably damaging	1.00
R8121:Setx	UTSW	2	29145034	missense	possibly damaging	0.93
R8284:Setx	UTSW	2	29145336	missense	possibly damaging	0.46
R8301:Setx	UTSW	2	29145690	missense	possibly damaging	0.69
R8752:Setx	UTSW	2	29158980	missense	probably damaging	0.97
R8785:Setx	UTSW	2	29145263	missense	probably damaging	1.00
R8871:Setx	UTSW	2	29148102	missense	probably benign	0.11
R8927:Setx	UTSW	2	29126959	missense	possibly damaging	0.59
R8928:Setx	UTSW	2	29126959	missense	possibly damaging	0.59
R9182:Setx	UTSW	2	29171287	missense	probably damaging	1.00
R9334:Setx	UTSW	2	29154020	nonsense	probably null
R9335:Setx	UTSW	2	29145951	missense	probably benign	0.00
R9491:Setx	UTSW	2	29147823	missense	probably benign	0.03
R9551:Setx	UTSW	2	29130232	missense	possibly damaging	0.80
R9627:Setx	UTSW	2	29144649	missense	probably damaging	1.00
R9688:Setx	UTSW	2	29146316	missense	probably damaging	1.00
R9689:Setx	UTSW	2	29161543	missense	probably damaging	1.00
R9747:Setx	UTSW	2	29174365	nonsense	probably null
R9780:Setx	UTSW	2	29126987	missense	possibly damaging	0.88
X0066:Setx	UTSW	2	29147879	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGTCACCCTTCCAGTATATAGAGAG -3'
(R):5'- AATAAACTCAGGATCTTAGGTGGG -3'

Sequencing Primer
(F):5'- ACTTTGGAACTTAGTGCAAAGG -3'
(R):5'- CTCAGGATCTTAGGTGGGAAAATAG -3'

Posted On

2015-06-20