Incidental Mutation 'R2350:Vmn2r101'
ID246083
Institutional Source Beutler Lab
Gene Symbol Vmn2r101
Ensembl Gene ENSMUSG00000094892
Gene Namevomeronasal 2, receptor 101
SynonymsEG627576
MMRRC Submission 040332-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R2350 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location19577231-19612317 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19589783 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 277 (V277A)
Ref Sequence ENSEMBL: ENSMUSP00000131583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171914]
Predicted Effect probably benign
Transcript: ENSMUST00000171914
AA Change: V277A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000131583
Gene: ENSMUSG00000094892
AA Change: V277A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 466 1.6e-36 PFAM
Pfam:NCD3G 509 562 6.4e-22 PFAM
Pfam:7tm_3 595 830 1.4e-51 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,678,088 probably benign Het
Adam12 T C 7: 133,919,524 T312A probably damaging Het
Adamts20 C T 15: 94,283,916 C1632Y probably damaging Het
Ago2 T C 15: 73,119,461 M543V probably benign Het
Alpk3 T C 7: 81,094,970 L1271P probably damaging Het
Arpin T A 7: 79,931,805 K56* probably null Het
Ccdc138 G T 10: 58,561,893 probably benign Het
Ccdc63 A T 5: 122,122,885 M192K probably benign Het
Cldn12 A T 5: 5,507,845 V194D possibly damaging Het
Cntnap5b T C 1: 100,379,126 L485P probably damaging Het
Cpne7 A G 8: 123,124,469 D165G probably damaging Het
Cyp2j6 A T 4: 96,529,408 M326K probably damaging Het
D630003M21Rik T A 2: 158,201,011 T870S probably damaging Het
Dennd2c A G 3: 103,132,001 D155G probably benign Het
Dnah3 A T 7: 120,045,788 probably null Het
Dqx1 T A 6: 83,059,087 C133* probably null Het
Fam234b T A 6: 135,231,724 V545E probably damaging Het
Flcn T C 11: 59,792,659 H564R probably damaging Het
Gsdmc4 T A 15: 63,893,165 H348L probably benign Het
Gucy2c G T 6: 136,763,074 P252T probably damaging Het
Insl6 T A 19: 29,325,245 E24V possibly damaging Het
Irx1 T A 13: 71,960,048 T172S probably damaging Het
Mocos C T 18: 24,666,656 probably benign Het
Myom2 T C 8: 15,108,835 V837A probably benign Het
Nfatc2ip T C 7: 126,395,998 N126S probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Npepl1 T C 2: 174,111,773 S166P probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr867 G T 9: 20,055,088 A125D probably damaging Het
Otop2 T G 11: 115,326,850 C171G probably damaging Het
Parpbp C A 10: 88,133,088 probably benign Het
Pcdhb20 T A 18: 37,504,510 S30T probably benign Het
Phkg1 A T 5: 129,864,532 V359E probably damaging Het
Ppp2cb A G 8: 33,611,827 D131G probably null Het
Scn9a A G 2: 66,504,968 Y1226H probably damaging Het
Unc5b A G 10: 60,778,200 F290S probably benign Het
Vmn1r71 A G 7: 10,747,919 F215L probably benign Het
Vmn2r6 T C 3: 64,556,352 S354G probably benign Het
Zfp292 A T 4: 34,811,281 S588T probably damaging Het
Other mutations in Vmn2r101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:Vmn2r101 APN 17 19589674 missense probably damaging 0.99
IGL02125:Vmn2r101 APN 17 19589701 missense possibly damaging 0.95
IGL02300:Vmn2r101 APN 17 19611937 missense probably damaging 1.00
IGL02682:Vmn2r101 APN 17 19612245 missense possibly damaging 0.82
IGL02825:Vmn2r101 APN 17 19589870 missense probably benign 0.00
IGL02862:Vmn2r101 APN 17 19611605 missense probably damaging 1.00
IGL02943:Vmn2r101 APN 17 19611404 missense probably damaging 0.99
R0371:Vmn2r101 UTSW 17 19590132 missense probably benign 0.07
R0462:Vmn2r101 UTSW 17 19590169 missense probably benign 0.04
R0492:Vmn2r101 UTSW 17 19588983 missense probably damaging 1.00
R0654:Vmn2r101 UTSW 17 19590111 missense probably benign 0.01
R1120:Vmn2r101 UTSW 17 19577461 splice site probably benign
R1323:Vmn2r101 UTSW 17 19612051 missense probably damaging 1.00
R1323:Vmn2r101 UTSW 17 19612051 missense probably damaging 1.00
R1676:Vmn2r101 UTSW 17 19611922 missense probably benign 0.00
R2023:Vmn2r101 UTSW 17 19590106 nonsense probably null
R2149:Vmn2r101 UTSW 17 19588963 missense probably benign 0.00
R2760:Vmn2r101 UTSW 17 19589639 missense probably benign 0.14
R3085:Vmn2r101 UTSW 17 19588815 splice site probably null
R3086:Vmn2r101 UTSW 17 19588815 splice site probably null
R3719:Vmn2r101 UTSW 17 19589549 missense possibly damaging 0.50
R3771:Vmn2r101 UTSW 17 19589657 missense probably benign
R3773:Vmn2r101 UTSW 17 19589657 missense probably benign
R4225:Vmn2r101 UTSW 17 19611689 missense probably damaging 1.00
R4248:Vmn2r101 UTSW 17 19589114 missense probably damaging 1.00
R4290:Vmn2r101 UTSW 17 19612041 missense probably damaging 1.00
R4291:Vmn2r101 UTSW 17 19612041 missense probably damaging 1.00
R4293:Vmn2r101 UTSW 17 19612041 missense probably damaging 1.00
R4307:Vmn2r101 UTSW 17 19590161 missense probably damaging 1.00
R4721:Vmn2r101 UTSW 17 19612025 missense probably damaging 0.99
R4829:Vmn2r101 UTSW 17 19611967 missense probably benign 0.03
R5022:Vmn2r101 UTSW 17 19611387 critical splice acceptor site probably null
R5110:Vmn2r101 UTSW 17 19611635 missense possibly damaging 0.92
R5244:Vmn2r101 UTSW 17 19611526 missense probably damaging 1.00
R5397:Vmn2r101 UTSW 17 19588842 missense probably damaging 1.00
R5875:Vmn2r101 UTSW 17 19588830 missense probably damaging 0.99
R5944:Vmn2r101 UTSW 17 19589507 missense probably benign 0.00
R6216:Vmn2r101 UTSW 17 19591005 missense probably benign 0.00
R6334:Vmn2r101 UTSW 17 19589850 missense possibly damaging 0.83
R6512:Vmn2r101 UTSW 17 19588884 missense probably damaging 1.00
R6607:Vmn2r101 UTSW 17 19612034 missense probably damaging 1.00
R6965:Vmn2r101 UTSW 17 19591022 missense probably benign 0.00
R7101:Vmn2r101 UTSW 17 19589088 missense probably null 0.14
R7183:Vmn2r101 UTSW 17 19612178 missense probably damaging 1.00
R7344:Vmn2r101 UTSW 17 19611797 missense probably benign 0.38
R7375:Vmn2r101 UTSW 17 19611390 missense probably damaging 1.00
R7574:Vmn2r101 UTSW 17 19611637 missense possibly damaging 0.91
R7575:Vmn2r101 UTSW 17 19611392 missense probably benign 0.01
R7592:Vmn2r101 UTSW 17 19591181 splice site probably null
R7626:Vmn2r101 UTSW 17 19611930 nonsense probably null
R7715:Vmn2r101 UTSW 17 19611915 missense probably damaging 1.00
R7730:Vmn2r101 UTSW 17 19611688 missense possibly damaging 0.81
R8078:Vmn2r101 UTSW 17 19590245 missense probably benign 0.07
R8228:Vmn2r101 UTSW 17 19591022 missense probably benign 0.00
R8283:Vmn2r101 UTSW 17 19611991 missense probably damaging 1.00
R8712:Vmn2r101 UTSW 17 19591135 missense probably benign 0.24
R8765:Vmn2r101 UTSW 17 19588983 missense probably damaging 1.00
Z1088:Vmn2r101 UTSW 17 19588975 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- ATGGGTTGGTCTCATACTCCCTG -3'
(R):5'- CCACAGCTTAGGAAGATAAATGTC -3'

Sequencing Primer
(F):5'- GGTTGGTCTCATACTCCCTGATGAC -3'
(R):5'- GCTTCCATGGAATGAGTCT -3'
Posted On2014-10-30