Incidental Mutation 'R4447:Mipol1'
ID328809
Institutional Source Beutler Lab
Gene Symbol Mipol1
Ensembl Gene ENSMUSG00000047022
Gene Namemirror-image polydactyly 1
Synonyms1700081O04Rik, 6030439O22Rik, D12Ertd19e
MMRRC Submission 041708-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4447 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location57230427-57497199 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 57352748 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123498] [ENSMUST00000130447] [ENSMUST00000145003] [ENSMUST00000153137]
Predicted Effect probably benign
Transcript: ENSMUST00000123498
SMART Domains Protein: ENSMUSP00000119636
Gene: ENSMUSG00000047022

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128945
Predicted Effect probably benign
Transcript: ENSMUST00000130447
SMART Domains Protein: ENSMUSP00000119918
Gene: ENSMUSG00000047022

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000145003
SMART Domains Protein: ENSMUSP00000121617
Gene: ENSMUSG00000047022

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150292
Predicted Effect probably benign
Transcript: ENSMUST00000153137
SMART Domains Protein: ENSMUSP00000117005
Gene: ENSMUSG00000047022

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153439
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein may function as a tumor suppressor. A translocation that results in truncation of the protein encoded by this locus has been associated with mirror-image polydactyly, also known as Laurin-Sandrow Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,198 T603A probably benign Het
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsf2 G T 11: 94,569,359 P389Q possibly damaging Het
Aldh6a1 A G 12: 84,439,709 V120A possibly damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ankar A G 1: 72,687,789 S415P possibly damaging Het
Ano3 A T 2: 110,761,578 probably null Het
Asic4 A T 1: 75,470,370 probably benign Het
Atp1a4 A C 1: 172,234,431 I709S probably damaging Het
Cyp11b2 T C 15: 74,855,563 I90V probably benign Het
Fam129a A T 1: 151,636,402 probably null Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Irf5 T A 6: 29,535,942 D318E probably damaging Het
Map2k3 A T 11: 60,947,171 S253C probably damaging Het
Mgst1 G T 6: 138,141,664 probably benign Het
Olfr371 T A 8: 85,231,366 Y290* probably null Het
Pomgnt1 G T 4: 116,152,923 V161L possibly damaging Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Rxfp1 C T 3: 79,652,127 probably benign Het
Scn5a T C 9: 119,550,627 D197G probably damaging Het
Thsd7a G A 6: 12,324,635 T1479I probably damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Ubqln3 C T 7: 104,142,814 R23Q probably benign Het
Vmn1r228 T C 17: 20,777,107 I50V probably damaging Het
Wnk4 T A 11: 101,268,451 S565T possibly damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Zfp407 A T 18: 84,562,694 V98D possibly damaging Het
Zfp598 T A 17: 24,676,555 V73E probably damaging Het
Zscan29 T A 2: 121,169,886 probably null Het
Other mutations in Mipol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Mipol1 APN 12 57307353 splice site probably benign
IGL01139:Mipol1 APN 12 57306035 nonsense probably null
IGL02679:Mipol1 APN 12 57306043 missense possibly damaging 0.84
IGL03109:Mipol1 APN 12 57364224 missense probably benign 0.20
R0001:Mipol1 UTSW 12 57460839 splice site probably benign
R0220:Mipol1 UTSW 12 57457150 missense probably damaging 1.00
R0271:Mipol1 UTSW 12 57460954 unclassified probably benign
R0284:Mipol1 UTSW 12 57457069 missense probably damaging 0.98
R0496:Mipol1 UTSW 12 57457177 missense probably damaging 0.99
R0538:Mipol1 UTSW 12 57414411 critical splice donor site probably null
R1082:Mipol1 UTSW 12 57325616 missense probably damaging 0.98
R1552:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R1558:Mipol1 UTSW 12 57332341 missense probably damaging 1.00
R1928:Mipol1 UTSW 12 57332419 missense probably damaging 1.00
R2104:Mipol1 UTSW 12 57306056 splice site probably null
R2495:Mipol1 UTSW 12 57460990 splice site probably benign
R3723:Mipol1 UTSW 12 57457092 missense probably damaging 1.00
R4431:Mipol1 UTSW 12 57303524 missense possibly damaging 0.58
R4654:Mipol1 UTSW 12 57306132 missense probably benign 0.22
R4847:Mipol1 UTSW 12 57303496 missense probably damaging 0.99
R4851:Mipol1 UTSW 12 57332301 missense probably damaging 1.00
R5113:Mipol1 UTSW 12 57496499 missense probably benign 0.36
R5668:Mipol1 UTSW 12 57325560 missense possibly damaging 0.48
R6535:Mipol1 UTSW 12 57306100 missense possibly damaging 0.95
R7172:Mipol1 UTSW 12 57325535 missense possibly damaging 0.95
R7191:Mipol1 UTSW 12 57457066 missense probably benign 0.01
R7560:Mipol1 UTSW 12 57306073 missense possibly damaging 0.94
R8508:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CGTCCATTTGTGCAGCAAC -3'
(R):5'- AGTTTTCAGATACTTAGGACAGTCC -3'

Sequencing Primer
(F):5'- GCAACTGCCAACTTTGCATTAAG -3'
(R):5'- CTGTTTGCTATCTAAATGGACTTGAG -3'
Posted On2015-07-21