Mutagenetix > Incidental Mutations

Incidental Mutation 'R2760:Btnl1'

254021

Institutional Source

Beutler Lab

Gene Symbol

Btnl1

Ensembl Gene

ENSMUSG00000062638

Gene Name

butyrophilin-like 1

Synonyms

Btnl3, LOC240074, LOC240074, NG10

Accession Numbers

Genbank: NM_001111094; MGI: 1932027

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2760 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34377132-34385776 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 34381038 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Glycine at position 172 (W172G)

Ref Sequence

ENSEMBL: ENSMUSP00000079140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080254]

Predicted Effect

probably damaging
Transcript: ENSMUST00000080254
AA Change: W172G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000079140
Gene: ENSMUSG00000062638
AA Change: W172G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
IGv	48	129	1.28e-10	SMART
Blast:IG_like	153	223	1e-26	BLAST
transmembrane domain	249	271	N/A	INTRINSIC
Pfam:SPRY	389	506	1.8e-9	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alg11	C	A	8: 22,068,079	A469E	probably benign	Het
Atp8a2	C	T	14: 59,860,192	V796I	probably benign	Het
Ceacam1	T	C	7: 25,477,474	T21A	probably damaging	Het
Fam69b	A	G	2: 26,635,825	H257R	probably benign	Het
Frmpd1	A	C	4: 45,244,667	I119L	possibly damaging	Het
Haus6	A	T	4: 86,583,176	Y819*	probably null	Het
Ildr2	A	G	1: 166,303,606	R344G	probably damaging	Het
Irs1	T	C	1: 82,288,570	I642V	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Lum	T	C	10: 97,568,771	V176A	probably benign	Het
Nobox	A	G	6: 43,304,106	L478P	probably damaging	Het
Olfr1200	T	A	2: 88,767,636	R226S	possibly damaging	Het
Olfr1415	A	G	1: 92,491,080	V225A	probably damaging	Het
Olfr544	T	C	7: 102,484,376	H248R	probably damaging	Het
Olfr8	A	T	10: 78,956,042	Y279F	probably damaging	Het
Olfr981	T	A	9: 40,022,396	M1K	probably null	Het
Rtn1	A	T	12: 72,408,362	C64S	probably benign	Het
Senp6	A	G	9: 80,121,978	Y285C	probably null	Het
Slco1a5	C	A	6: 142,250,271	M335I	probably benign	Het
Spg11	A	T	2: 122,097,359	I648K	probably damaging	Het
Ube2cbp	T	C	9: 86,422,974	I272V	probably benign	Het
Ulk1	C	T	5: 110,789,357	R691Q	probably benign	Het
Utrn	A	G	10: 12,690,878	V1180A	probably damaging	Het
Vill	T	C	9: 119,066,882		probably null	Het
Vmn2r101	T	C	17: 19,589,639	I229T	probably benign	Het
Zbtb8b	A	T	4: 129,432,500	L291M	probably benign	Het

Other mutations in Btnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Btnl1	APN	17	34381117	missense	probably damaging	1.00
IGL01743:Btnl1	APN	17	34385685	missense	probably damaging	1.00
IGL02194:Btnl1	APN	17	34379535	missense	possibly damaging	0.90
IGL02329:Btnl1	APN	17	34382265	missense	possibly damaging	0.85
IGL03275:Btnl1	APN	17	34385512	missense	probably damaging	0.99
3-1:Btnl1	UTSW	17	34381056	missense	probably damaging	1.00
R0021:Btnl1	UTSW	17	34379494	missense	probably benign	0.01
R0021:Btnl1	UTSW	17	34379494	missense	probably benign	0.01
R0371:Btnl1	UTSW	17	34381057	missense	probably damaging	0.99
R1689:Btnl1	UTSW	17	34381208	nonsense	probably null
R1982:Btnl1	UTSW	17	34379751	missense	possibly damaging	0.81
R2109:Btnl1	UTSW	17	34379604	missense	probably damaging	1.00
R2134:Btnl1	UTSW	17	34385634	missense	possibly damaging	0.48
R4084:Btnl1	UTSW	17	34381159	missense	possibly damaging	0.91
R4586:Btnl1	UTSW	17	34382462	missense	probably damaging	1.00
R4611:Btnl1	UTSW	17	34379725	missense	probably damaging	0.99
R4625:Btnl1	UTSW	17	34379751	missense	probably null	0.99
R5579:Btnl1	UTSW	17	34381552	critical splice donor site	probably null
R5811:Btnl1	UTSW	17	34385529	missense	probably damaging	1.00
R6380:Btnl1	UTSW	17	34379494	missense	probably benign	0.01
R6602:Btnl1	UTSW	17	34385748	missense	probably damaging	0.99
R6633:Btnl1	UTSW	17	34385331	missense	possibly damaging	0.86
R8134:Btnl1	UTSW	17	34385673	missense	possibly damaging	0.86
R8136:Btnl1	UTSW	17	34380040	splice site	probably null
R8840:Btnl1	UTSW	17	34385603	missense	probably benign	0.17
RF041:Btnl1	UTSW	17	34381368	missense	probably benign	0.04
X0026:Btnl1	UTSW	17	34377932	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGCAGTGTCACAGGGTAGC -3'
(R):5'- CCTGTCAGAGTTTGGTCCTC -3'

Sequencing Primer
(F):5'- AGTGTCACAGGGTAGCCTCAG -3'
(R):5'- CGATTTCTCCTGGTCATACATGGG -3'

Posted On

2014-12-04