Incidental Mutation 'RF041:Btnl1'
ID604839
Institutional Source Beutler Lab
Gene Symbol Btnl1
Ensembl Gene ENSMUSG00000062638
Gene Namebutyrophilin-like 1
SynonymsBtnl3, LOC240074, LOC240074, NG10
Accession Numbers

Genbank: NM_001111094; MGI: 1932027

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF041 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34377132-34385776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34381368 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 246 (T246M)
Ref Sequence ENSEMBL: ENSMUSP00000079140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080254]
Predicted Effect probably benign
Transcript: ENSMUST00000080254
AA Change: T246M

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000079140
Gene: ENSMUSG00000062638
AA Change: T246M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IGv 48 129 1.28e-10 SMART
Blast:IG_like 153 223 1e-26 BLAST
transmembrane domain 249 271 N/A INTRINSIC
Pfam:SPRY 389 506 1.8e-9 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik TGAGGA TGA 12: 72,881,276 probably benign Het
5430401F13Rik CCAGCAAAAACAGAAAGGAAAAGG CCAGCAAAAACAGAAAGGAAAAGGAGGCCAGCAAAAACAGAAAGGAAAAGG 6: 131,552,873 probably benign Het
5430401F13Rik AAAGGTGGC AAAGGTGGCAAGCAAAAACAGAAAGGAGAAGGTGGC 6: 131,552,892 probably benign Het
5430401F13Rik AGGTGGCCAG AGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,894 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GGCTGC GGCTGCGGCATCCTGTGCTGC 4: 155,905,100 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,229 probably benign Het
Arid1b CGG CGGTGG 17: 4,995,595 probably benign Het
AY761185 CACTGTGGG C 8: 20,943,912 probably null Het
Cdc40 C T 10: 40,843,123 D337N probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cul9 CCT CCTACT 17: 46,500,854 probably null Het
Defb22 GCTGGCCTTTGC GCTGGCCTTTGCCGCAGACCTGGCCTTTGC 2: 152,485,823 probably benign Het
Dmkn GGGGTGGAAG GGGGTGGAAGGGGTGGAAGTGGTGGAAGGGGTGGAAG 7: 30,767,173 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAATCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Flywch1 GT GTGGGGAGGCTACGTACTCACCCACTCCTGGTTT 17: 23,762,177 probably null Het
Gabre CTCCGG CTCCGGATCCGG X: 72,270,049 probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,758 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Il2 GG GGGCTTGAAGTGCG 3: 37,125,842 probably benign Het
Iqcf4 CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTACTTTTCATTTTCCTTTT 9: 106,570,613 probably null Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
Kmt2c TG TGTTGCAG 5: 25,315,775 probably benign Het
Lce1m CTGCTGCTGCC CTGCTGCTGCCCTTGCTGCTGCC 3: 93,018,141 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,829 probably benign Het
Med12l AGC AGCTGC 3: 59,275,985 probably benign Het
Med12l GC GCACC 3: 59,275,995 probably benign Het
Nefh CCTCACCTGGGG CCTCACCTGGGGCCTTGGGCTCACCTGGGG 11: 4,941,039 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Nusap1 GTGAGGAGCAAGCTGA GTGAGGAGCAAGCTGAAATACACGTTAGCAATGAGGAGCAAGCTGA 2: 119,627,593 probably benign Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Setd1a GGTGGTGGT GGTGGTGGTCGTGGTGGT 7: 127,785,332 probably benign Het
Sfr1 ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCCCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC 19: 47,732,868 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 AGC AGCCCCTGC 19: 26,631,021 probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tcof1 AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGCGATCCCCTTGGC 18: 60,833,572 probably benign Het
Tcof1 CCCCTTG CCCCTTGACTGCTGAGATGGGCACTTTCCCAGAGATGCCCTTG 18: 60,833,576 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Unc13b AGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG AGCCAGAGCCAGAGCCAGGGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG 4: 43,177,338 probably benign Het
Usp19 GTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGT 9: 108,493,988 unknown Het
Other mutations in Btnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Btnl1 APN 17 34381117 missense probably damaging 1.00
IGL01743:Btnl1 APN 17 34385685 missense probably damaging 1.00
IGL02194:Btnl1 APN 17 34379535 missense possibly damaging 0.90
IGL02329:Btnl1 APN 17 34382265 missense possibly damaging 0.85
IGL03275:Btnl1 APN 17 34385512 missense probably damaging 0.99
3-1:Btnl1 UTSW 17 34381056 missense probably damaging 1.00
R0021:Btnl1 UTSW 17 34379494 missense probably benign 0.01
R0021:Btnl1 UTSW 17 34379494 missense probably benign 0.01
R0371:Btnl1 UTSW 17 34381057 missense probably damaging 0.99
R1689:Btnl1 UTSW 17 34381208 nonsense probably null
R1982:Btnl1 UTSW 17 34379751 missense possibly damaging 0.81
R2109:Btnl1 UTSW 17 34379604 missense probably damaging 1.00
R2134:Btnl1 UTSW 17 34385634 missense possibly damaging 0.48
R2760:Btnl1 UTSW 17 34381038 missense probably damaging 1.00
R4084:Btnl1 UTSW 17 34381159 missense possibly damaging 0.91
R4586:Btnl1 UTSW 17 34382462 missense probably damaging 1.00
R4611:Btnl1 UTSW 17 34379725 missense probably damaging 0.99
R4625:Btnl1 UTSW 17 34379751 missense probably null 0.99
R5579:Btnl1 UTSW 17 34381552 critical splice donor site probably null
R5811:Btnl1 UTSW 17 34385529 missense probably damaging 1.00
R6380:Btnl1 UTSW 17 34379494 missense probably benign 0.01
R6602:Btnl1 UTSW 17 34385748 missense probably damaging 0.99
R6633:Btnl1 UTSW 17 34385331 missense possibly damaging 0.86
R8134:Btnl1 UTSW 17 34385673 missense possibly damaging 0.86
X0026:Btnl1 UTSW 17 34377932 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCAATGTGATCTGCTCCATC -3'
(R):5'- ATGCTGCTGTCCCCACATATAC -3'

Sequencing Primer
(F):5'- ATGTGATCTGCTCCATCCAAAATC -3'
(R):5'- ACCTCTGATCTTCAGTACAGATTTTG -3'
Posted On2019-12-04