Incidental Mutation 'R2940:Gm13101'
ID255123
Institutional Source Beutler Lab
Gene Symbol Gm13101
Ensembl Gene ENSMUSG00000078510
Gene Namepredicted gene 13101
Synonyms
MMRRC Submission 040517-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2940 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location143964518-143966950 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143966677 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 77 (V77A)
Ref Sequence ENSEMBL: ENSMUSP00000101389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105763]
Predicted Effect probably benign
Transcript: ENSMUST00000105763
AA Change: V77A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101389
Gene: ENSMUSG00000078510
AA Change: V77A

DomainStartEndE-ValueType
SCOP:d1a4ya_ 210 414 2e-9 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Cngb1 T C 8: 95,252,107 I573V probably benign Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dmap1 G A 4: 117,676,005 T284M possibly damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif3a T C 19: 60,773,677 T487A probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Isl1 T C 13: 116,308,299 T65A possibly damaging Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Lman1 G T 18: 65,984,273 P466Q possibly damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Plek C T 11: 16,992,887 probably null Het
Rasgrf1 C T 9: 89,991,714 A692V possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Tubb6 A G 18: 67,401,924 N298D probably damaging Het
Xpo7 A T 14: 70,667,136 L1020Q probably damaging Het
Xpo7 G T 14: 70,667,137 L1020I probably benign Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Gm13101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Gm13101 APN 4 143966614 splice site probably benign
IGL00688:Gm13101 APN 4 143965822 missense possibly damaging 0.62
IGL00690:Gm13101 APN 4 143965822 missense possibly damaging 0.62
IGL00693:Gm13101 APN 4 143965822 missense possibly damaging 0.62
IGL00694:Gm13101 APN 4 143965822 missense possibly damaging 0.62
IGL01412:Gm13101 APN 4 143964995 missense probably damaging 1.00
IGL01781:Gm13101 APN 4 143965729 missense probably benign
IGL02426:Gm13101 APN 4 143966659 missense possibly damaging 0.75
IGL02508:Gm13101 APN 4 143965020 missense probably benign 0.13
IGL03338:Gm13101 APN 4 143965841 missense probably benign 0.01
IGL03338:Gm13101 APN 4 143966038 missense probably benign 0.03
R0201:Gm13101 UTSW 4 143964890 missense probably damaging 1.00
R0325:Gm13101 UTSW 4 143966740 missense probably damaging 1.00
R0538:Gm13101 UTSW 4 143965083 missense possibly damaging 0.76
R1471:Gm13101 UTSW 4 143964953 missense probably benign 0.25
R1544:Gm13101 UTSW 4 143966062 missense probably benign 0.00
R1891:Gm13101 UTSW 4 143966665 missense probably damaging 1.00
R2012:Gm13101 UTSW 4 143966067 missense probably benign 0.00
R2105:Gm13101 UTSW 4 143965820 missense probably benign
R2939:Gm13101 UTSW 4 143966677 missense probably benign 0.00
R3723:Gm13101 UTSW 4 143966681 missense probably benign
R3952:Gm13101 UTSW 4 143965786 nonsense probably null
R4028:Gm13101 UTSW 4 143965784 missense probably benign 0.02
R4029:Gm13101 UTSW 4 143965784 missense probably benign 0.02
R4030:Gm13101 UTSW 4 143965784 missense probably benign 0.02
R5059:Gm13101 UTSW 4 143964995 missense probably damaging 0.99
R5222:Gm13101 UTSW 4 143964792 missense possibly damaging 0.55
R5591:Gm13101 UTSW 4 143964960 missense probably damaging 1.00
R5677:Gm13101 UTSW 4 143965138 missense possibly damaging 0.59
R6021:Gm13101 UTSW 4 143965766 missense probably benign
R6042:Gm13101 UTSW 4 143966061 missense probably benign 0.04
R6155:Gm13101 UTSW 4 143965142 missense probably benign 0.00
R6604:Gm13101 UTSW 4 143965997 missense probably benign 0.02
R6807:Gm13101 UTSW 4 143965011 missense probably damaging 1.00
R7244:Gm13101 UTSW 4 143965885 missense probably benign
R7505:Gm13101 UTSW 4 143964986 missense probably benign 0.00
R7526:Gm13101 UTSW 4 143965817 missense probably benign 0.00
R8121:Gm13101 UTSW 4 143965041 missense probably benign 0.01
R8408:Gm13101 UTSW 4 143965642 missense probably benign
R8890:Gm13101 UTSW 4 143964924 missense probably benign 0.10
Z1088:Gm13101 UTSW 4 143965562 missense probably benign
Z1177:Gm13101 UTSW 4 143965591 missense probably benign 0.42
Z1177:Gm13101 UTSW 4 143965775 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCAGGACAGTGTAGCTCTTCAAG -3'
(R):5'- ACTCCTGAGCTTGGCAGTACAG -3'

Sequencing Primer
(F):5'- CAGTGTAGCTCTTCAAGATGATACC -3'
(R):5'- CCTGGCGAAGAATGAAGCCTTG -3'
Posted On2014-12-29