Mutagenetix > Incidental Mutation

Incidental Mutation 'R2940:Gm13101'

255123

Institutional Source

Beutler Lab

Gene Symbol

Gm13101

Ensembl Gene

ENSMUSG00000078510

Gene Name

predicted gene 13101

Synonyms

MMRRC Submission

040517-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R2940 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

143964518-143966950 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 143966677 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 77 (V77A)

Ref Sequence

ENSEMBL: ENSMUSP00000101389 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105763]

AlphaFold

A2ASJ0

Predicted Effect

probably benign
Transcript: ENSMUST00000105763
AA Change: V77A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000101389
Gene: ENSMUSG00000078510
AA Change: V77A

Domain	Start	End	E-Value	Type
SCOP:d1a4ya_	210	414	2e-9	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 36,958,805	D1878G	probably damaging	Het
Adcy2	A	G	13: 68,730,305	W405R	probably damaging	Het
Apc	G	A	18: 34,276,670	R221H	probably damaging	Het
Armcx6	A	T	X: 134,749,876	W69R	probably damaging	Het
Carm1	C	A	9: 21,579,396		probably null	Het
Clasrp	C	A	7: 19,585,240		probably benign	Het
Cngb1	T	C	8: 95,252,107	I573V	probably benign	Het
Crybg2	A	G	4: 134,082,434	H1517R	possibly damaging	Het
Dixdc1	G	A	9: 50,710,959	A25V	probably damaging	Het
Dmap1	G	A	4: 117,676,005	T284M	possibly damaging	Het
Dock6	A	G	9: 21,839,200	F473L	possibly damaging	Het
Eif3a	T	C	19: 60,773,677	T487A	probably benign	Het
Elmsan1	C	T	12: 84,156,471	G886S	probably benign	Het
Faiml	A	G	9: 99,232,474	C121R	probably damaging	Het
Fam180a	A	T	6: 35,313,629	S140T	possibly damaging	Het
Fibcd1	T	C	2: 31,817,264	Y327C	probably damaging	Het
Haghl	A	G	17: 25,785,086	V8A	possibly damaging	Het
Igfbp1	A	G	11: 7,201,970	T258A	probably benign	Het
Isl1	T	C	13: 116,308,299	T65A	possibly damaging	Het
Khdrbs3	T	A	15: 69,049,390	D185E	probably damaging	Het
Klc1	C	T	12: 111,806,017	R157C	possibly damaging	Het
Lamc3	A	G	2: 31,940,702	S1484G	probably benign	Het
Lman1	G	T	18: 65,984,273	P466Q	possibly damaging	Het
Map3k4	C	T	17: 12,261,270	E682K	probably damaging	Het
Myo9b	G	A	8: 71,334,337	R721Q	probably benign	Het
Nbea	C	G	3: 55,934,624	E1879Q	probably benign	Het
Olfr870	C	A	9: 20,170,765	G269W	probably benign	Het
Olfr954	G	A	9: 39,461,930	M166I	probably benign	Het
Pigc	T	C	1: 161,970,670	Y74H	possibly damaging	Het
Plek	C	T	11: 16,992,887		probably null	Het
Rasgrf1	C	T	9: 89,991,714	A692V	possibly damaging	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rnf25	A	G	1: 74,595,888	V135A	possibly damaging	Het
Senp6	G	A	9: 80,143,842	A1134T	probably benign	Het
Sh3rf2	G	A	18: 42,111,440		probably null	Het
Sh3tc2	A	G	18: 61,989,686	D506G	probably damaging	Het
Slc13a1	T	A	6: 24,090,780	I547F	possibly damaging	Het
Slc26a6	G	A	9: 108,857,037	V206I	probably benign	Het
Smc1a	T	A	X: 152,033,699	Y516N	probably damaging	Het
Sorbs1	T	C	19: 40,373,571	D123G	probably damaging	Het
Tecta	A	T	9: 42,377,994	M425K	possibly damaging	Het
Trpv1	A	G	11: 73,254,849	K403R	probably damaging	Het
Ttc39d	A	G	17: 80,217,553	Y547C	probably damaging	Het
Tubb6	A	G	18: 67,401,924	N298D	probably damaging	Het
Xpo7	A	T	14: 70,667,136	L1020Q	probably damaging	Het
Xpo7	G	T	14: 70,667,137	L1020I	probably benign	Het
Zswim4	A	T	8: 84,223,748	L611Q	probably damaging	Het

Other mutations in Gm13101

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Gm13101	APN	4	143966614	splice site	probably benign
IGL00688:Gm13101	APN	4	143965822	missense	possibly damaging	0.62
IGL00690:Gm13101	APN	4	143965822	missense	possibly damaging	0.62
IGL00693:Gm13101	APN	4	143965822	missense	possibly damaging	0.62
IGL00694:Gm13101	APN	4	143965822	missense	possibly damaging	0.62
IGL01412:Gm13101	APN	4	143964995	missense	probably damaging	1.00
IGL01781:Gm13101	APN	4	143965729	missense	probably benign
IGL02426:Gm13101	APN	4	143966659	missense	possibly damaging	0.75
IGL02508:Gm13101	APN	4	143965020	missense	probably benign	0.13
IGL03338:Gm13101	APN	4	143965841	missense	probably benign	0.01
IGL03338:Gm13101	APN	4	143966038	missense	probably benign	0.03
R0201:Gm13101	UTSW	4	143964890	missense	probably damaging	1.00
R0325:Gm13101	UTSW	4	143966740	missense	probably damaging	1.00
R0538:Gm13101	UTSW	4	143965083	missense	possibly damaging	0.76
R1471:Gm13101	UTSW	4	143964953	missense	probably benign	0.25
R1544:Gm13101	UTSW	4	143966062	missense	probably benign	0.00
R1891:Gm13101	UTSW	4	143966665	missense	probably damaging	1.00
R2012:Gm13101	UTSW	4	143966067	missense	probably benign	0.00
R2105:Gm13101	UTSW	4	143965820	missense	probably benign
R2939:Gm13101	UTSW	4	143966677	missense	probably benign	0.00
R3723:Gm13101	UTSW	4	143966681	missense	probably benign
R3952:Gm13101	UTSW	4	143965786	nonsense	probably null
R4028:Gm13101	UTSW	4	143965784	missense	probably benign	0.02
R4029:Gm13101	UTSW	4	143965784	missense	probably benign	0.02
R4030:Gm13101	UTSW	4	143965784	missense	probably benign	0.02
R5059:Gm13101	UTSW	4	143964995	missense	probably damaging	0.99
R5222:Gm13101	UTSW	4	143964792	missense	possibly damaging	0.55
R5591:Gm13101	UTSW	4	143964960	missense	probably damaging	1.00
R5677:Gm13101	UTSW	4	143965138	missense	possibly damaging	0.59
R6021:Gm13101	UTSW	4	143965766	missense	probably benign
R6042:Gm13101	UTSW	4	143966061	missense	probably benign	0.04
R6155:Gm13101	UTSW	4	143965142	missense	probably benign	0.00
R6604:Gm13101	UTSW	4	143965997	missense	probably benign	0.02
R6807:Gm13101	UTSW	4	143965011	missense	probably damaging	1.00
R7244:Gm13101	UTSW	4	143965885	missense	probably benign
R7505:Gm13101	UTSW	4	143964986	missense	probably benign	0.00
R7526:Gm13101	UTSW	4	143965817	missense	probably benign	0.00
R8121:Gm13101	UTSW	4	143965041	missense	probably benign	0.01
R8408:Gm13101	UTSW	4	143965642	missense	probably benign
R8890:Gm13101	UTSW	4	143964924	missense	probably benign	0.10
R8989:Gm13101	UTSW	4	143965200	missense	probably benign	0.04
R9054:Gm13101	UTSW	4	143965744	missense	probably benign	0.18
Z1088:Gm13101	UTSW	4	143965562	missense	probably benign
Z1177:Gm13101	UTSW	4	143965591	missense	probably benign	0.42
Z1177:Gm13101	UTSW	4	143965775	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CCAGGACAGTGTAGCTCTTCAAG -3'
(R):5'- ACTCCTGAGCTTGGCAGTACAG -3'

Sequencing Primer
(F):5'- CAGTGTAGCTCTTCAAGATGATACC -3'
(R):5'- CCTGGCGAAGAATGAAGCCTTG -3'

Posted On

2014-12-29