Incidental Mutation 'R2940:Eif3a'
ID255167
Institutional Source Beutler Lab
Gene Symbol Eif3a
Ensembl Gene ENSMUSG00000024991
Gene Nameeukaryotic translation initiation factor 3, subunit A
SynonymsEif3s10, A830012B05Rik, Eif3, Csma
MMRRC Submission 040517-MU
Accession Numbers

Genbank: NM_010123

Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R2940 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location60761116-60790693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60773677 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 487 (T487A)
Ref Sequence ENSEMBL: ENSMUSP00000025955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025955]
Predicted Effect probably benign
Transcript: ENSMUST00000025955
AA Change: T487A

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025955
Gene: ENSMUSG00000024991
AA Change: T487A

DomainStartEndE-ValueType
coiled coil region 82 120 N/A INTRINSIC
PINT 426 506 5.69e-18 SMART
SCOP:d1f5aa2 563 711 5e-3 SMART
coiled coil region 772 880 N/A INTRINSIC
low complexity region 919 947 N/A INTRINSIC
low complexity region 951 976 N/A INTRINSIC
internal_repeat_2 978 991 1.01e-8 PROSPERO
low complexity region 993 1007 N/A INTRINSIC
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1033 1057 N/A INTRINSIC
low complexity region 1064 1089 N/A INTRINSIC
internal_repeat_1 1090 1111 6.2e-12 PROSPERO
internal_repeat_2 1099 1112 1.01e-8 PROSPERO
internal_repeat_1 1110 1131 6.2e-12 PROSPERO
low complexity region 1146 1173 N/A INTRINSIC
low complexity region 1176 1206 N/A INTRINSIC
low complexity region 1221 1260 N/A INTRINSIC
low complexity region 1265 1297 N/A INTRINSIC
low complexity region 1301 1314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199618
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI

All alleles(36) : Targeted, other(2) Gene trapped(34)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,805 D1878G probably damaging Het
Adcy2 A G 13: 68,730,305 W405R probably damaging Het
Apc G A 18: 34,276,670 R221H probably damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Cngb1 T C 8: 95,252,107 I573V probably benign Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dmap1 G A 4: 117,676,005 T284M possibly damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam180a A T 6: 35,313,629 S140T possibly damaging Het
Fibcd1 T C 2: 31,817,264 Y327C probably damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Igfbp1 A G 11: 7,201,970 T258A probably benign Het
Isl1 T C 13: 116,308,299 T65A possibly damaging Het
Khdrbs3 T A 15: 69,049,390 D185E probably damaging Het
Klc1 C T 12: 111,806,017 R157C possibly damaging Het
Lamc3 A G 2: 31,940,702 S1484G probably benign Het
Lman1 G T 18: 65,984,273 P466Q possibly damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbea C G 3: 55,934,624 E1879Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pigc T C 1: 161,970,670 Y74H possibly damaging Het
Plek C T 11: 16,992,887 probably null Het
Rasgrf1 C T 9: 89,991,714 A692V possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Sh3rf2 G A 18: 42,111,440 probably null Het
Sh3tc2 A G 18: 61,989,686 D506G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Sorbs1 T C 19: 40,373,571 D123G probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Tubb6 A G 18: 67,401,924 N298D probably damaging Het
Xpo7 A T 14: 70,667,136 L1020Q probably damaging Het
Xpo7 G T 14: 70,667,137 L1020I probably benign Het
Zswim4 A T 8: 84,223,748 L611Q probably damaging Het
Other mutations in Eif3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Eif3a APN 19 60769890 missense unknown
IGL00981:Eif3a APN 19 60766611 missense unknown
IGL01650:Eif3a APN 19 60773996 missense probably damaging 1.00
IGL01926:Eif3a APN 19 60769961 missense unknown
IGL02100:Eif3a APN 19 60767004 splice site probably benign
IGL02316:Eif3a APN 19 60771638 splice site probably benign
IGL02444:Eif3a APN 19 60773607 missense possibly damaging 0.89
IGL02552:Eif3a APN 19 60763226 unclassified probably benign
IGL02797:Eif3a APN 19 60772726 missense probably damaging 1.00
IGL03108:Eif3a APN 19 60782309 missense possibly damaging 0.85
FR4304:Eif3a UTSW 19 60775290 critical splice donor site probably benign
FR4548:Eif3a UTSW 19 60775291 critical splice donor site probably benign
FR4737:Eif3a UTSW 19 60775289 critical splice donor site probably benign
FR4976:Eif3a UTSW 19 60775291 critical splice donor site probably benign
G5538:Eif3a UTSW 19 60781902 missense probably damaging 0.97
R0054:Eif3a UTSW 19 60766826 missense unknown
R0054:Eif3a UTSW 19 60766826 missense unknown
R1483:Eif3a UTSW 19 60768726 missense unknown
R1636:Eif3a UTSW 19 60781905 missense possibly damaging 0.93
R1748:Eif3a UTSW 19 60766798 missense unknown
R1857:Eif3a UTSW 19 60782197 missense probably damaging 1.00
R1858:Eif3a UTSW 19 60782197 missense probably damaging 1.00
R1993:Eif3a UTSW 19 60781516 missense probably benign 0.19
R2034:Eif3a UTSW 19 60762130 unclassified probably benign
R2099:Eif3a UTSW 19 60764113 unclassified probably benign
R2140:Eif3a UTSW 19 60775394 splice site probably benign
R2434:Eif3a UTSW 19 60764050 unclassified probably benign
R4630:Eif3a UTSW 19 60769928 missense unknown
R4630:Eif3a UTSW 19 60777986 missense probably benign 0.41
R4926:Eif3a UTSW 19 60763218 unclassified probably benign
R5366:Eif3a UTSW 19 60779533 missense probably benign 0.12
R6003:Eif3a UTSW 19 60766881 missense unknown
R6082:Eif3a UTSW 19 60772130 missense possibly damaging 0.82
R6256:Eif3a UTSW 19 60771026 missense possibly damaging 0.72
R7056:Eif3a UTSW 19 60763062 splice site probably null
R7365:Eif3a UTSW 19 60766644 missense unknown
R8076:Eif3a UTSW 19 60773925 missense probably damaging 0.97
R8169:Eif3a UTSW 19 60762190 missense unknown
R8246:Eif3a UTSW 19 60779368 missense probably damaging 1.00
X0028:Eif3a UTSW 19 60781902 missense probably damaging 0.97
X0066:Eif3a UTSW 19 60762293 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCAGAATGTGAGCAGGTCTG -3'
(R):5'- CCTGCAGGTATGTGTTATAAGGAG -3'

Sequencing Primer
(F):5'- CAGGTCTGATGACTTCAAGTGC -3'
(R):5'- GAACTAGAAAGACACAACTCTTTGG -3'
Posted On2014-12-29