Incidental Mutation 'R3723:Gm13101'
ID270622
Institutional Source Beutler Lab
Gene Symbol Gm13101
Ensembl Gene ENSMUSG00000078510
Gene Namepredicted gene 13101
Synonyms
MMRRC Submission 040714-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R3723 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location143964518-143966950 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143966681 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 76 (T76A)
Ref Sequence ENSEMBL: ENSMUSP00000101389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105763]
Predicted Effect probably benign
Transcript: ENSMUST00000105763
AA Change: T76A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101389
Gene: ENSMUSG00000078510
AA Change: T76A

DomainStartEndE-ValueType
SCOP:d1a4ya_ 210 414 2e-9 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 95% (38/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,016,853 V5167A possibly damaging Het
Ano5 A G 7: 51,576,528 Y510C probably damaging Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Apob A T 12: 8,006,327 Q1570L probably damaging Het
Apob A G 12: 8,011,763 N3415S possibly damaging Het
Arsk T A 13: 76,066,653 I361F probably damaging Het
C9 G A 15: 6,483,080 E228K possibly damaging Het
Celsr2 A G 3: 108,397,415 probably benign Het
Cfap53 A G 18: 74,359,569 I455V probably benign Het
Ckap4 A G 10: 84,528,392 L269P probably damaging Het
Dnah7a T A 1: 53,447,346 D3352V probably benign Het
Dync2h1 A T 9: 7,041,658 M3335K probably benign Het
Fam171a1 A G 2: 3,220,375 probably benign Het
Glis3 A T 19: 28,262,591 C97* probably null Het
Gm14221 C G 2: 160,568,427 noncoding transcript Het
Gm8603 A C 17: 13,516,813 probably null Het
Gm9767 G T 10: 26,078,571 probably benign Het
Kctd16 A G 18: 40,258,859 T167A possibly damaging Het
Kif18b A G 11: 102,916,276 F78L probably damaging Het
Mefv A G 16: 3,708,194 probably null Het
Mipol1 C A 12: 57,457,092 L349I probably damaging Het
Myo10 T C 15: 25,803,288 V1527A probably damaging Het
Naip5 G T 13: 100,223,014 Y571* probably null Het
Npl A G 1: 153,515,464 F182L probably benign Het
Pan3 T A 5: 147,503,208 probably benign Het
Pcdh15 A T 10: 74,645,848 T342S probably benign Het
Pcdhga1 A G 18: 37,662,992 T350A possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rere A G 4: 150,468,795 E148G probably damaging Het
Scube2 T C 7: 109,808,406 probably benign Het
Sptbn1 A G 11: 30,137,335 S1035P possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Supt3 A G 17: 44,994,387 D108G probably damaging Het
Tnfsf13b A G 8: 10,031,545 I236V possibly damaging Het
Tns1 T C 1: 73,924,940 S1511G probably damaging Het
Tpm1 G A 9: 67,031,945 probably benign Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Vmn1r117 T A 7: 20,883,455 I223F probably damaging Het
Vmn2r91 G A 17: 18,085,278 probably null Het
Zfp30 A G 7: 29,793,353 E344G probably damaging Het
Other mutations in Gm13101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Gm13101 APN 4 143966614 splice site probably benign
IGL00688:Gm13101 APN 4 143965822 missense possibly damaging 0.62
IGL00690:Gm13101 APN 4 143965822 missense possibly damaging 0.62
IGL00693:Gm13101 APN 4 143965822 missense possibly damaging 0.62
IGL00694:Gm13101 APN 4 143965822 missense possibly damaging 0.62
IGL01412:Gm13101 APN 4 143964995 missense probably damaging 1.00
IGL01781:Gm13101 APN 4 143965729 missense probably benign
IGL02426:Gm13101 APN 4 143966659 missense possibly damaging 0.75
IGL02508:Gm13101 APN 4 143965020 missense probably benign 0.13
IGL03338:Gm13101 APN 4 143965841 missense probably benign 0.01
IGL03338:Gm13101 APN 4 143966038 missense probably benign 0.03
R0201:Gm13101 UTSW 4 143964890 missense probably damaging 1.00
R0325:Gm13101 UTSW 4 143966740 missense probably damaging 1.00
R0538:Gm13101 UTSW 4 143965083 missense possibly damaging 0.76
R1471:Gm13101 UTSW 4 143964953 missense probably benign 0.25
R1544:Gm13101 UTSW 4 143966062 missense probably benign 0.00
R1891:Gm13101 UTSW 4 143966665 missense probably damaging 1.00
R2012:Gm13101 UTSW 4 143966067 missense probably benign 0.00
R2105:Gm13101 UTSW 4 143965820 missense probably benign
R2939:Gm13101 UTSW 4 143966677 missense probably benign 0.00
R2940:Gm13101 UTSW 4 143966677 missense probably benign 0.00
R3952:Gm13101 UTSW 4 143965786 nonsense probably null
R4028:Gm13101 UTSW 4 143965784 missense probably benign 0.02
R4029:Gm13101 UTSW 4 143965784 missense probably benign 0.02
R4030:Gm13101 UTSW 4 143965784 missense probably benign 0.02
R5059:Gm13101 UTSW 4 143964995 missense probably damaging 0.99
R5222:Gm13101 UTSW 4 143964792 missense possibly damaging 0.55
R5591:Gm13101 UTSW 4 143964960 missense probably damaging 1.00
R5677:Gm13101 UTSW 4 143965138 missense possibly damaging 0.59
R6021:Gm13101 UTSW 4 143965766 missense probably benign
R6042:Gm13101 UTSW 4 143966061 missense probably benign 0.04
R6155:Gm13101 UTSW 4 143965142 missense probably benign 0.00
R6604:Gm13101 UTSW 4 143965997 missense probably benign 0.02
R6807:Gm13101 UTSW 4 143965011 missense probably damaging 1.00
R7244:Gm13101 UTSW 4 143965885 missense probably benign
R7505:Gm13101 UTSW 4 143964986 missense probably benign 0.00
R7526:Gm13101 UTSW 4 143965817 missense probably benign 0.00
Z1088:Gm13101 UTSW 4 143965562 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCCAGGACAGTGTAGCTC -3'
(R):5'- TCCTGAGCTTGGCAGTACAGAG -3'

Sequencing Primer
(F):5'- TCCAGGACAGTGTAGCTCTTCAAG -3'
(R):5'- GCAGTACAGAGCCTGGC -3'
Posted On2015-03-18