Mutagenetix > Incidental Mutations

Incidental Mutation 'R2875:Gm5346'

260511

Institutional Source

Beutler Lab

Gene Symbol

Gm5346

Ensembl Gene

ENSMUSG00000050190

Gene Name

predicted gene 5346

Synonyms

MMRRC Submission

040463-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R2875 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43624951-43627276 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 43627140 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 16 (K16*)

Ref Sequence

ENSEMBL: ENSMUSP00000058858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056023]

Predicted Effect

probably null
Transcript: ENSMUST00000056023
AA Change: K16*

SMART Domains

Protein: ENSMUSP00000058858
Gene: ENSMUSG00000050190
AA Change: K16*

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
Pfam:Pep_M12B_propep	39	159	1.3e-18	PFAM
Pfam:Reprolysin_5	205	384	1.1e-15	PFAM
Pfam:Reprolysin_4	205	393	6.2e-9	PFAM
Pfam:Reprolysin	207	397	1.7e-46	PFAM
Pfam:Reprolysin_2	223	389	5.7e-14	PFAM
Pfam:Reprolysin_3	231	352	2.6e-13	PFAM
DISIN	416	491	2.48e-38	SMART
ACR	492	628	3.4e-65	SMART
EGF	634	664	2.69e1	SMART
transmembrane domain	685	707	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

100% (1/1)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	T	G	10: 10,422,719	T422P	probably damaging	Het
Adrm1	A	G	2: 180,175,618	T293A	probably damaging	Het
Baz1a	A	T	12: 54,923,119	D585E	probably damaging	Het
Ccdc152	T	C	15: 3,298,181	N38S	probably damaging	Het
Cenpf	A	G	1: 189,658,644	M997T	probably benign	Het
Dnah12	A	G	14: 26,693,470	I9V	probably benign	Het
Dnah12	A	G	14: 26,876,950	N995S	probably benign	Het
Dnah9	C	A	11: 66,168,461	G3C	possibly damaging	Het
Dock2	A	G	11: 34,718,885	S243P	probably damaging	Het
Eif2ak3	T	C	6: 70,883,639	S400P	probably damaging	Het
Eno1b	A	G	18: 48,047,784	K343R	possibly damaging	Het
Gm38394	C	T	1: 133,656,860	C913Y	probably damaging	Het
Grk6	A	G	13: 55,452,304	H271R	probably damaging	Het
H2-Ab1	A	C	17: 34,263,312	M1L	probably benign	Het
Irf8	C	A	8: 120,754,463	P262Q	probably damaging	Het
Kcnc3	G	T	7: 44,591,537	G218*	probably null	Het
Krt9	C	A	11: 100,189,205	G454*	probably null	Het
Mgrn1	C	T	16: 4,907,416	T47I	possibly damaging	Het
Ndst1	A	T	18: 60,690,047	F816I	probably damaging	Het
Olfr193	A	T	16: 59,109,802	D269E	probably benign	Het
Olfr742	T	A	14: 50,515,812	W203R	probably benign	Het
Phf12	C	A	11: 78,009,747	T223N	probably damaging	Het
Rad1	T	C	15: 10,490,331	V128A	probably benign	Het
Rad54l	C	T	4: 116,101,853	R382Q	probably benign	Het
Rhbdd1	A	G	1: 82,368,369	D215G	probably benign	Het
Sdc4	T	C	2: 164,431,291	D33G	possibly damaging	Het
Smarca4	A	T	9: 21,642,580	K387N	possibly damaging	Het
St3gal5	A	G	6: 72,147,130	M214V	possibly damaging	Het
Stk25	T	C	1: 93,629,251	D15G	possibly damaging	Het
Timm21	T	C	18: 84,951,092	D69G	probably benign	Het
Ttll4	A	G	1: 74,686,438		probably null	Het
Ttn	T	A	2: 76,759,094	N21272I	probably damaging	Het
Uchl3	A	G	14: 101,668,560	H153R	probably benign	Het
Zcwpw1	T	C	5: 137,810,042	S251P	probably damaging	Het
Zeb1	GGA	GGAAGA	18: 5,772,859		probably benign	Het
Zscan29	T	C	2: 121,164,100	Y468C	probably damaging	Het

Other mutations in Gm5346

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Gm5346	APN	8	43625381	missense	probably benign	0.12
IGL00391:Gm5346	APN	8	43625629	missense	probably damaging	1.00
IGL00422:Gm5346	APN	8	43626351	missense	probably damaging	1.00
IGL00664:Gm5346	APN	8	43625969	missense	probably benign
IGL01095:Gm5346	APN	8	43626096	missense	probably benign	0.22
IGL01113:Gm5346	APN	8	43626152	missense	probably damaging	1.00
IGL01444:Gm5346	APN	8	43626433	missense	probably benign	0.06
IGL01782:Gm5346	APN	8	43626735	missense	probably benign	0.01
IGL01921:Gm5346	APN	8	43625511	missense	probably damaging	0.96
IGL01964:Gm5346	APN	8	43626761	missense	probably benign	0.00
IGL02139:Gm5346	APN	8	43625578	missense	probably benign	0.01
IGL02555:Gm5346	APN	8	43625268	missense	probably damaging	1.00
IGL02951:Gm5346	APN	8	43627088	missense	possibly damaging	0.62
R0056:Gm5346	UTSW	8	43625503	nonsense	probably null
R0218:Gm5346	UTSW	8	43626440	missense	probably benign	0.00
R0530:Gm5346	UTSW	8	43626531	missense	probably benign	0.00
R0925:Gm5346	UTSW	8	43626303	missense	probably benign	0.11
R0927:Gm5346	UTSW	8	43625123	missense	probably benign	0.00
R0975:Gm5346	UTSW	8	43625118	missense	probably benign
R1300:Gm5346	UTSW	8	43626844	nonsense	probably null
R1728:Gm5346	UTSW	8	43625583	missense	probably damaging	1.00
R1729:Gm5346	UTSW	8	43625583	missense	probably damaging	1.00
R1801:Gm5346	UTSW	8	43625917	nonsense	probably null
R1869:Gm5346	UTSW	8	43625095	nonsense	probably null
R1870:Gm5346	UTSW	8	43625095	nonsense	probably null
R1871:Gm5346	UTSW	8	43625095	nonsense	probably null
R1992:Gm5346	UTSW	8	43627139	missense	probably benign	0.44
R2008:Gm5346	UTSW	8	43627037	missense	probably benign	0.00
R2013:Gm5346	UTSW	8	43626405	missense	possibly damaging	0.81
R2022:Gm5346	UTSW	8	43625917	nonsense	probably null
R2175:Gm5346	UTSW	8	43625438	missense	probably benign
R3406:Gm5346	UTSW	8	43626052	nonsense	probably null
R3845:Gm5346	UTSW	8	43626632	missense	probably benign	0.00
R4033:Gm5346	UTSW	8	43626673	missense	probably benign	0.28
R4072:Gm5346	UTSW	8	43626350	missense	probably damaging	1.00
R4074:Gm5346	UTSW	8	43626350	missense	probably damaging	1.00
R4075:Gm5346	UTSW	8	43626350	missense	probably damaging	1.00
R4076:Gm5346	UTSW	8	43626350	missense	probably damaging	1.00
R4153:Gm5346	UTSW	8	43626527	missense	probably benign	0.04
R4330:Gm5346	UTSW	8	43626250	missense	probably benign
R4612:Gm5346	UTSW	8	43626550	missense	probably benign	0.09
R4662:Gm5346	UTSW	8	43627079	missense	probably benign	0.26
R5032:Gm5346	UTSW	8	43626471	missense	probably damaging	1.00
R5077:Gm5346	UTSW	8	43627163	missense	possibly damaging	0.79
R5504:Gm5346	UTSW	8	43625282	missense	probably damaging	1.00
R5697:Gm5346	UTSW	8	43626579	missense	probably damaging	1.00
R6232:Gm5346	UTSW	8	43625912	missense	probably benign	0.00
R6233:Gm5346	UTSW	8	43625912	missense	probably benign	0.00
R6234:Gm5346	UTSW	8	43625912	missense	probably benign	0.00
R6235:Gm5346	UTSW	8	43625912	missense	probably benign	0.00
R6241:Gm5346	UTSW	8	43626096	missense	probably benign	0.22
R6392:Gm5346	UTSW	8	43626001	missense	probably benign	0.09
R6439:Gm5346	UTSW	8	43625951	missense	probably damaging	1.00
R6454:Gm5346	UTSW	8	43626808	missense	probably damaging	0.96
R6455:Gm5346	UTSW	8	43626152	missense	probably damaging	1.00
R6767:Gm5346	UTSW	8	43626914	missense	probably damaging	1.00
R6774:Gm5346	UTSW	8	43625183	missense	probably benign	0.00
R6877:Gm5346	UTSW	8	43625237	missense	probably benign	0.02
R6911:Gm5346	UTSW	8	43625109	missense	probably benign	0.02
R7211:Gm5346	UTSW	8	43625877	missense	probably damaging	1.00
R7597:Gm5346	UTSW	8	43625244	missense	probably damaging	1.00
R7602:Gm5346	UTSW	8	43626666	missense	probably damaging	0.99
R7797:Gm5346	UTSW	8	43626374	missense	probably benign	0.04
R7981:Gm5346	UTSW	8	43625813	missense	probably damaging	1.00
R8154:Gm5346	UTSW	8	43625387	missense	probably damaging	0.97
R8215:Gm5346	UTSW	8	43626501	missense	probably benign	0.05
RF001:Gm5346	UTSW	8	43626905	missense	possibly damaging	0.79
Z1177:Gm5346	UTSW	8	43626546	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGTGATTATGTGCCTCTGCC -3'
(R):5'- TGCCATCTAAGTTAATTGTCGGTG -3'

Sequencing Primer
(F):5'- CCCCCAATGCTCAGGCTATAGG -3'
(R):5'- TCTAAGTTAATTGTCGGTGATTTACC -3'

Genotyping

NOTE: These primers have not been validated.

R2875:Gm5346 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.

PCR Primers

R28750019_Gm5346_PCR_F: 5’- AGTGATTATGTGCCTCTGCC-3’

R28750019_Gm5346_PCR_R: 5’- TGCCATCTAAGTTAATTGTCGGTG-3’

Sequencing Primers

R28750019_Gm5346_SEQ_F: 5’- CCCCCAATGCTCAGGCTATAGG-3’ 

R28750019_Gm5346_SEQ_R: 5’- TCTAAGTTAATTGTCGGTGATTTACC-3’ 

PCR program

1) 94°C 2:00

2) 94°C 0:30

3) 55°C 0:30

4) 72°C 1:00

5) repeat steps (2-4) 40X

6) 72°C 10:00

7) 4°C hold

The following sequence of 415 nucleotides is amplified (Chr.8: 43626961-43627375, GRCm38; NCBI RefSeq: NC_000074):

agtgattatg tgcctctgcc ccccaatgct caggctatag gacagccaac ctggtgaact

attatttcct ctagtgacag tgaccctcaa gggtgtcact acttctggaa ggctactgta

cttagcatgt ccaattggtg aatatgcaga gaagaagaac attgtccaca ggcagaactt

aaggaacatg ttccttttat ggaccacgac cttagcccca gtcattatat cctattagag

agccaaggag gagcttgaga agttcttgtt gtcccagtcc tcactttgtg tggttgcagg

tagcactggt gtcttctgac acggttgagt cataagggtg gtaggactaa aagaaacagg

caaataaagg caaacatagt tattggtaaa tcaccgacaa ttaacttaga tggca

FASTA sequence

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated T is shown in red text (Chr. + strand, T>A; Sense strand, A>T).

Posted On

2015-01-23